Annexin A8 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80505-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Annexin A8 Reagents
CRO Services
Product recommended

All Annexin A8 Reagents
Annexin A8 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
984 bp
Description
Full length Clone DNA of Rat annexin A8 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Annexin A8 Background Information
Full Name
annexin A8

Annexin A8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Annexin A8 cDNA ORF Clone in Cloning Vector, Rat RG80505-U
Annexin A8 cDNA ORF Clone, Rat, untagged RG80505-UT
Annexin A8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80505-ACG
Annexin A8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80505-ACGLN
Annexin A8 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80505-ANG
Annexin A8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80505-ACR
Annexin A8 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80505-ANR
Annexin A8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80505-CF
Annexin A8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80505-NF
Annexin A8 cDNA ORF Clone, Rat, C-His tag RG80505-CH
Annexin A8 cDNA ORF Clone, Rat, N-His tag RG80505-NH
Annexin A8 cDNA ORF Clone, Rat, N-HA tag RG80505-NY
Annexin A8 cDNA ORF Clone, Rat, C-Myc tag RG80505-CM
Annexin A8 cDNA ORF Clone, Rat, N-Myc tag RG80505-NM
Annexin A8 qPCR Primer Pairs, Rat RP300469

Annexin A8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Annexin A8 cDNA ORF Clone in Cloning Vector, Human HG15421-G
Annexin A8 cDNA ORF Clone, Human, untagged HG15421-UT
Annexin A8 cDNA ORF Clone, Human, C-GFPSpark® tag HG15421-ACG
Annexin A8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15421-ACGLN
Annexin A8 cDNA ORF Clone, Human, N-GFPSpark® tag HG15421-ANG
Annexin A8 cDNA ORF Clone, Human, C-OFPSpark® tag HG15421-ACR
Annexin A8 cDNA ORF Clone, Human, N-OFPSpark® tag HG15421-ANR
Annexin A8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15421-CF
Annexin A8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15421-NF
Annexin A8 cDNA ORF Clone, Human, C-His tag HG15421-CH
Annexin A8 cDNA ORF Clone, Human, N-His tag HG15421-NH
Annexin A8 cDNA ORF Clone, Human, C-HA tag HG15421-CY
Annexin A8 cDNA ORF Clone, Human, N-HA tag HG15421-NY
Annexin A8 cDNA ORF Clone, Human, C-Myc tag HG15421-CM
Annexin A8 cDNA ORF Clone, Human, N-Myc tag HG15421-NM
Annexin A8 qPCR Primer Pairs, Human HP104045
info info
添加购物车成功! 添加购物车失败!