Annexin V cDNA ORF Clone, Rat, C-His tag

Cat: RG80610-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Annexin V Reagents
CRO Services
Product recommended

All Annexin V Reagents
Annexin V cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
960 bp
Description
Full length Clone DNA of Rat annexin A5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Annexin V Background Information
Full Name
annexin A5
References
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Annexin V cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Annexin V cDNA ORF Clone in Cloning Vector, Rat RG80610-U
    Annexin V cDNA ORF Clone, Rat, untagged RG80610-UT
    Annexin V cDNA ORF Clone, Rat, C-GFPSpark® tag RG80610-ACG
    Annexin V Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80610-ACGLN
    Annexin V cDNA ORF Clone, Rat, N-GFPSpark® tag RG80610-ANG
    Annexin V cDNA ORF Clone, Rat, C-OFPSpark® tag RG80610-ACR
    Annexin V cDNA ORF Clone, Rat, N-OFPSpark® tag RG80610-ANR
    Annexin V cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80610-CF
    Annexin V cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80610-NF
    Annexin V cDNA ORF Clone, Rat, N-His tag RG80610-NH
    Annexin V cDNA ORF Clone, Rat, C-HA tag RG80610-CY
    Annexin V cDNA ORF Clone, Rat, N-HA tag RG80610-NY
    Annexin V cDNA ORF Clone, Rat, C-Myc tag RG80610-CM
    Annexin V cDNA ORF Clone, Rat, N-Myc tag RG80610-NM
    Annexin V qPCR Primer Pairs, Rat RP300574

    Annexin V cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Annexin V cDNA ORF Clone in Cloning Vector, Mouse MG52083-G
    Annexin V cDNA ORF Clone, Mouse, untagged MG52083-UT
    Annexin V cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52083-ACG
    Annexin V Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52083-ACGLN
    Annexin V cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52083-ANG
    Annexin V cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52083-ACR
    Annexin V cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52083-ANR
    Annexin V cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52083-CF
    Annexin V cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52083-NF
    Annexin V cDNA ORF Clone, Mouse, C-His tag MG52083-CH
    Annexin V cDNA ORF Clone, Mouse, N-His tag MG52083-NH
    Annexin V cDNA ORF Clone, Mouse, C-HA tag MG52083-CY
    Annexin V cDNA ORF Clone, Mouse, N-HA tag MG52083-NY
    Annexin V cDNA ORF Clone, Mouse, C-Myc tag MG52083-CM
    Annexin V cDNA ORF Clone, Mouse, N-Myc tag MG52083-NM
    Annexin V qPCR Primer Pairs, Mouse MP201956

    Annexin V cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Annexin V cDNA ORF Clone in Cloning Vector, Human HG10448-M
    Annexin V cDNA ORF Clone, Human, untagged HG10448-UT
    Annexin V cDNA ORF Clone, Human, C-GFPSpark® tag HG10448-ACG
    Annexin V Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10448-ACGLN
    Annexin V cDNA ORF Clone, Human, N-GFPSpark® tag HG10448-ANG
    Annexin V cDNA ORF Clone, Human, C-OFPSpark® tag HG10448-ACR
    Annexin V cDNA ORF Clone, Human, N-OFPSpark® tag HG10448-ANR
    Annexin V cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10448-CF
    Annexin V cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10448-NF
    Annexin V cDNA ORF Clone, Human, C-His tag HG10448-CH
    Annexin V cDNA ORF Clone, Human, N-His tag HG10448-NH
    Annexin V cDNA ORF Clone, Human, C-HA tag HG10448-CY
    Annexin V cDNA ORF Clone, Human, N-HA tag HG10448-NY
    Annexin V cDNA ORF Clone, Human, C-Myc tag HG10448-CM
    Annexin V cDNA ORF Clone, Human, N-Myc tag HG10448-NM
    Annexin V qPCR Primer Pairs, Human HP100477
    info info
    添加购物车成功! 添加购物车失败!