Quick Order

Rat ANXA5 ORF mammalian expression plasmid, N-HA tag

Datasheet Reviews Related Products Protocols
Rat ANXA5 cDNA Clone Product Information
NCBI RefSeq:NM_013132.1
RefSeq ORF Size:960bp
cDNA Description:Full length Clone DNA of Rattus norvegicus annexin A5 with N terminal HA tag.
Gene Synonym:LC5, Anx5
Species:Rat
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
References
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
  • Size / Price
    Catalog:  RG80610-NY
    List Price:    (Save )
    Price:       [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"