Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-His tag

Cat: RG80644-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Annexin A2/ANXA2 Reagents
CRO Services
Product recommended

All Annexin A2/ANXA2 Reagents
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1020 bp
Description
Full length Clone DNA of Rat annexin A2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-His tag Alternative Names
ANX2 cDNA ORF Clone, Rat
Annexin A2/ANXA2 Background Information
Full Name
annexin A2

Annexin A2/ANXA2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Ferret FG60086-G
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, untagged FG60086-UT
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60086-ACG
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60086-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60086-ANG
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60086-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60086-ANR
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60086-CF
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60086-NF
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-His tag FG60086-CH
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-His tag FG60086-NH
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-HA tag FG60086-CY
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-HA tag FG60086-NY
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-Myc tag FG60086-CM
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-Myc tag FG60086-NM

Annexin A2/ANXA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Rat RG80644-U
Annexin A2/ANXA2 cDNA ORF Clone, Rat, untagged RG80644-UT
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80644-ACG
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80644-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80644-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80644-CF
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80644-NF
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-His tag RG80644-CH
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-HA tag RG80644-CY
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-HA tag RG80644-NY
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-Myc tag RG80644-CM
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-Myc tag RG80644-NM
Annexin A2/ANXA2 qPCR Primer Pairs, Rat RP300608

Annexin A2/ANXA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Mouse MG52756-G
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, untagged MG52756-UT
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52756-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52756-ACG
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52756-ANG
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52756-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52756-ANR
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52756-CF
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52756-NF
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-His tag MG52756-CH
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-His tag MG52756-NH
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-HA tag MG52756-CY
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-HA tag MG52756-NY
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-Myc tag MG52756-CM
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-Myc tag MG52756-NM

Annexin A2/ANXA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Human HG13517-G
Annexin A2/ANXA2 cDNA ORF Clone, Human, untagged HG13517-UT
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13517-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13517-ACG
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13517-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13517-CF
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13517-NF
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-His tag HG13517-CH
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-His tag HG13517-NH
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-HA tag HG13517-CY
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-HA tag HG13517-NY
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-Myc tag HG13517-CM
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-Myc tag HG13517-NM
Annexin A2/ANXA2 qPCR Primer Pairs, Human HP102204
info info
添加购物车成功! 添加购物车失败!