Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80608-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Annexin A1/ANXA1 Reagents
CRO Services
Product recommended

All Annexin A1/ANXA1 Reagents
Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rat annexin A1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Annexin A1/ANXA1 Background Information
Full Name
annexin A1

Annexin A1/ANXA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Annexin A1/ANXA1 cDNA ORF Clone in Cloning Vector, Rat RG80608-U
Annexin A1/ANXA1 cDNA ORF Clone, Rat, untagged RG80608-UT
Annexin A1/ANXA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80608-ACGLN
Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80608-ACG
Annexin A1/ANXA1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80608-ANG
Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80608-ACR
Annexin A1/ANXA1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80608-ANR
Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80608-CF
Annexin A1/ANXA1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80608-NF
Annexin A1/ANXA1 cDNA ORF Clone, Rat, N-His tag RG80608-NH
Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-HA tag RG80608-CY
Annexin A1/ANXA1 cDNA ORF Clone, Rat, N-HA tag RG80608-NY
Annexin A1/ANXA1 cDNA ORF Clone, Rat, C-Myc tag RG80608-CM
Annexin A1/ANXA1 cDNA ORF Clone, Rat, N-Myc tag RG80608-NM
Annexin A1/ANXA1 qPCR Primer Pairs, Rat RP300572

Annexin A1/ANXA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Annexin A1/ANXA1 cDNA ORF Clone in Cloning Vector, Mouse MG53690-U
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, untagged MG53690-UT
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53690-ACG
Annexin A1/ANXA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53690-ACGLN
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53690-ANG
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53690-ACR
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53690-ANR
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53690-CF
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53690-NF
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, C-His tag MG53690-CH
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, N-His tag MG53690-NH
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, C-HA tag MG53690-CY
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, N-HA tag MG53690-NY
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, C-Myc tag MG53690-CM
Annexin A1/ANXA1 cDNA ORF Clone, Mouse, N-Myc tag MG53690-NM

Annexin A1/ANXA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Annexin A1/ANXA1 cDNA ORF Clone in Cloning Vector, Human HG12113-M
Annexin A1/ANXA1 cDNA ORF Clone, Human, untagged HG12113-UT
Annexin A1/ANXA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12113-ACGLN
Annexin A1/ANXA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12113-ACG
Annexin A1/ANXA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12113-ACR
Annexin A1/ANXA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12113-CF
Annexin A1/ANXA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12113-NF
Annexin A1/ANXA1 cDNA ORF Clone, Human, C-His tag HG12113-CH
Annexin A1/ANXA1 cDNA ORF Clone, Human, N-His tag HG12113-NH
Annexin A1/ANXA1 cDNA ORF Clone, Human, C-HA tag HG12113-CY
Annexin A1/ANXA1 cDNA ORF Clone, Human, N-HA tag HG12113-NY
Annexin A1/ANXA1 cDNA ORF Clone, Human, C-Myc tag HG12113-CM
Annexin A1/ANXA1 cDNA ORF Clone, Human, N-Myc tag HG12113-NM
Annexin A1/ANXA1 qPCR Primer Pairs, Human HP101640
info info
添加购物车成功! 添加购物车失败!