ALKBH3/ABH3 cDNA ORF Clone, Rat, untagged

Cat: RG81237-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALKBH3/ABH3 Reagents
CRO Services
Product recommended

All ALKBH3/ABH3 Reagents
ALKBH3/ABH3 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Rat alkB, alkylation repair homolog 3 (E. coli).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALKBH3/ABH3 Background Information
Full Name
alkB, alkylation repair homolog 3 (E. coli)

ALKBH3/ABH3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ALKBH3/ABH3 cDNA ORF Clone in Cloning Vector, Rat RG81237-U
ALKBH3/ABH3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81237-ACGLN
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81237-ACG
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81237-ANG
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81237-ACR
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81237-ANR
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81237-CF
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81237-NF
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-His tag RG81237-CH
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-His tag RG81237-NH
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-HA tag RG81237-CY
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-HA tag RG81237-NY
ALKBH3/ABH3 cDNA ORF Clone, Rat, C-Myc tag RG81237-CM
ALKBH3/ABH3 cDNA ORF Clone, Rat, N-Myc tag RG81237-NM
ALKBH3/ABH3 qPCR Primer Pairs, Rat RP301193

ALKBH3/ABH3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALKBH3/ABH3 cDNA ORF Clone in Cloning Vector, Mouse MG53270-U
ALKBH3/ABH3 cDNA ORF Clone, Mouse, untagged MG53270-UT
ALKBH3/ABH3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53270-ACGLN
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53270-ACG
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53270-ANG
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53270-ACR
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53270-ANR
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53270-CF
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53270-NF
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-His tag MG53270-CH
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-His tag MG53270-NH
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-HA tag MG53270-CY
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-HA tag MG53270-NY
ALKBH3/ABH3 cDNA ORF Clone, Mouse, C-Myc tag MG53270-CM
ALKBH3/ABH3 cDNA ORF Clone, Mouse, N-Myc tag MG53270-NM

ALKBH3/ABH3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALKBH3/ABH3 cDNA ORF Clone in Cloning Vector, Human HG15639-G
ALKBH3/ABH3 cDNA ORF Clone, Human, untagged HG15639-UT
ALKBH3/ABH3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15639-ACGLN
ALKBH3/ABH3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15639-ACG
ALKBH3/ABH3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15639-ANG
ALKBH3/ABH3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15639-ACR
ALKBH3/ABH3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15639-ANR
ALKBH3/ABH3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15639-CF
ALKBH3/ABH3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15639-NF
ALKBH3/ABH3 cDNA ORF Clone, Human, C-His tag HG15639-CH
ALKBH3/ABH3 cDNA ORF Clone, Human, N-His tag HG15639-NH
ALKBH3/ABH3 cDNA ORF Clone, Human, C-HA tag HG15639-CY
ALKBH3/ABH3 cDNA ORF Clone, Human, N-HA tag HG15639-NY
ALKBH3/ABH3 cDNA ORF Clone, Human, C-Myc tag HG15639-CM
ALKBH3/ABH3 cDNA ORF Clone, Human, N-Myc tag HG15639-NM
ALKBH3/ABH3 qPCR Primer Pairs, Human HP104257
info info
添加购物车成功! 添加购物车失败!