ALG14 cDNA ORF Clone, Rat, C-His tag

Cat: RG81185-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ALG14 Reagents
CRO Services
Product recommended

All ALG14 Reagents
ALG14 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Rat ALG14, UDP-N-acetylglucosaminyltransferase subunit with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALG14 Background Information
Full Name
ALG14, UDP-N-acetylglucosaminyltransferase subunit

ALG14 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ALG14 cDNA ORF Clone in Cloning Vector, Rat RG81185-U
ALG14 cDNA ORF Clone, Rat, untagged RG81185-UT
ALG14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81185-ACGLN
ALG14 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81185-ACG
ALG14 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81185-ACR
ALG14 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81185-CF
ALG14 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81185-NF
ALG14 cDNA ORF Clone, Rat, N-His tag RG81185-NH
ALG14 cDNA ORF Clone, Rat, C-HA tag RG81185-CY
ALG14 cDNA ORF Clone, Rat, N-HA tag RG81185-NY
ALG14 cDNA ORF Clone, Rat, C-Myc tag RG81185-CM
ALG14 cDNA ORF Clone, Rat, N-Myc tag RG81185-NM
ALG14 qPCR Primer Pairs, Rat RP301141

ALG14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALG14 cDNA ORF Clone in Cloning Vector, Mouse MG54303-U
ALG14 cDNA ORF Clone, Mouse, untagged MG54303-UT
ALG14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54303-ACG
ALG14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54303-ACGLN
ALG14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54303-ACR
ALG14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54303-CF
ALG14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54303-NF
ALG14 cDNA ORF Clone, Mouse, C-His tag MG54303-CH
ALG14 cDNA ORF Clone, Mouse, N-His tag MG54303-NH
ALG14 cDNA ORF Clone, Mouse, C-HA tag MG54303-CY
ALG14 cDNA ORF Clone, Mouse, N-HA tag MG54303-NY
ALG14 cDNA ORF Clone, Mouse, C-Myc tag MG54303-CM
ALG14 cDNA ORF Clone, Mouse, N-Myc tag MG54303-NM

ALG14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALG14 cDNA ORF Clone in Cloning Vector, Human HG13460-G
ALG14 cDNA ORF Clone, Human, untagged HG13460-UT
ALG14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13460-ACGLN
ALG14 cDNA ORF Clone, Human, C-GFPSpark® tag HG13460-ACG
ALG14 cDNA ORF Clone, Human, C-OFPSpark® tag HG13460-ACR
ALG14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13460-CF
ALG14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13460-NF
ALG14 cDNA ORF Clone, Human, C-His tag HG13460-CH
ALG14 cDNA ORF Clone, Human, N-His tag HG13460-NH
ALG14 cDNA ORF Clone, Human, C-HA tag HG13460-CY
ALG14 cDNA ORF Clone, Human, N-HA tag HG13460-NY
ALG14 cDNA ORF Clone, Human, C-Myc tag HG13460-CM
ALG14 cDNA ORF Clone, Human, N-Myc tag HG13460-NM
ALG14 qPCR Primer Pairs, Human HP102160
info info
添加购物车成功! 添加购物车失败!