Quick Order

Rat ALDOB Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Rat ALDOB cDNA Clone Product Information
NCBI RefSeq:NM_012496.2
RefSeq ORF Size:1095bp
cDNA Description:Full length Clone DNA of Rattus norvegicus aldolase B, fructose-bisphosphate with C terminal His tag.
Gene Synonym:Aldo2, LIV10
Species:Rat
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Cox TM. (1994) Aldolase B and fructose intolerance. FASEB J. 8(1): 62-71.
  • Malay AD, et al. (2005) Structure of the thermolabile mutant aldolase B, A149P: molecular basis of hereditary fructose intolerance. J Mol Biol. 347(1): 135-44.
  • Susan PP, et al. (2001) Starvation-induced lysosomal degradation of aldolase B requires glutamine 111 in a signal sequence for chaperone-mediated transport. J Cell Physiol. 187(1): 48-58.
  • Size / Price
    Catalog: RG81082-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"