CD166 / ALCAM cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80221-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD166 / ALCAM Reagents
CRO Services
Product recommended

All CD166 / ALCAM Reagents
CD166 / ALCAM cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1752 bp
Description
Full length Clone DNA of Rat activated leukocyte cell adhesion molecule with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD166 / ALCAM Background Information

Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule belonging to the Ig superfamily and a ligand for CD6 that is expressed on T lymphocytes. The extracellular domain of ALCAM contains five Ig-like domains (three Ig-like C2-type domains and two Ig-like V-type domains), of which the amino-terminal V1 domain is essential for ligand binding and ALCAM-mediated cell aggregation. ALCAM mediates both heterophilic (ALCAM-CD6) and homophilic (ALCAM-ALCAM) cell-cell interactions. ALCAM/CD6 interaction plays a role in T cell development and T cell regulation, as well as in the binding of T- and B-cells to activated leukocytes. Recently, homophilic (ALCAM-ALCAM) adhesion was shown to play important roles in tight cell-to-cell interaction and regulation of stem cell differentiation. While expressed in a wide variety of tissues, ALCAM is usually restricted to subsets of cells involved in dynamic growth and/or migration, including neural development, branching organ development, hematopoiesis, immune response and tumor progression. And CD166 is regarded as a potential novel breast cancer indicator and therapeutic target.

Full Name
activated leukocyte cell adhesion molecule
References
  • Swart GW. (2002) Activated leukocyte cell adhesion molecule (CD166/ALCAM): developmental and mechanistic aspects of cell clustering and cell migration. Eur J Cell Biol. 81(6): 313-21.
  • Fujiwara H, et al. (2003) Human blastocysts and endometrial epithelial cells express activated leukocyte cell adhesion molecule (ALCAM/CD166). J Clin Endocrinol Metab. 88(7): 3437-43.
  • Jezierska A, et al. (2006) ALCAM/CD166 protects breast cancer cells against apoptosis and autophagy. Med Sci Monit. 12(8): BR263-73.
  • Kahlert C, et al. (2009) Increased expression of ALCAM/CD166 in pancreatic cancer is an independent prognostic marker for poor survival and early tumour relapse. Br J Cancer. 101(3): 457-64.
  • CD166 / ALCAM cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD166 / ALCAM cDNA ORF Clone in Cloning Vector, Rhesus CG90227-G
    CD166 / ALCAM cDNA ORF Clone, Rhesus, untagged CG90227-UT
    CD166 / ALCAM Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90227-ACGLN
    CD166 / ALCAM cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90227-ACG
    CD166 / ALCAM cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90227-ACR
    CD166 / ALCAM cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90227-CF
    CD166 / ALCAM cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90227-NF
    CD166 / ALCAM cDNA ORF Clone, Rhesus, C-His tag CG90227-CH
    CD166 / ALCAM cDNA ORF Clone, Rhesus, N-His tag CG90227-NH
    CD166 / ALCAM cDNA ORF Clone, Rhesus, C-HA tag CG90227-CY
    CD166 / ALCAM cDNA ORF Clone, Rhesus, N-HA tag CG90227-NY
    CD166 / ALCAM cDNA ORF Clone, Rhesus, C-Myc tag CG90227-CM
    CD166 / ALCAM cDNA ORF Clone, Rhesus, N-Myc tag CG90227-NM

    CD166 / ALCAM cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD166 / ALCAM cDNA ORF Clone in Cloning Vector, Rat RG80221-G
    CD166 / ALCAM cDNA ORF Clone, Rat, untagged RG80221-UT
    CD166 / ALCAM cDNA ORF Clone, Rat, C-GFPSpark® tag RG80221-ACG
    CD166 / ALCAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80221-ACGLN
    CD166 / ALCAM cDNA ORF Clone, Rat, C-OFPSpark® tag RG80221-ACR
    CD166 / ALCAM cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80221-CF
    CD166 / ALCAM cDNA ORF Clone, Rat, C-His tag RG80221-CH
    CD166 / ALCAM cDNA ORF Clone, Rat, N-His tag RG80221-NH
    CD166 / ALCAM cDNA ORF Clone, Rat, C-HA tag RG80221-CY
    CD166 / ALCAM cDNA ORF Clone, Rat, N-HA tag RG80221-NY
    CD166 / ALCAM cDNA ORF Clone, Rat, C-Myc tag RG80221-CM
    CD166 / ALCAM cDNA ORF Clone, Rat, N-Myc tag RG80221-NM
    CD166 / ALCAM qPCR Primer Pairs, Rat RP300212

    CD166 / ALCAM cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD166 / ALCAM cDNA ORF Clone in Cloning Vector, Mouse MG50005-M
    CD166 / ALCAM cDNA ORF Clone, Mouse, untagged MG50005-UT
    CD166 / ALCAM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50005-ACG
    CD166 / ALCAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50005-ACGLN
    CD166 / ALCAM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50005-ACR
    CD166 / ALCAM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50005-CF
    CD166 / ALCAM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50005-NF
    CD166 / ALCAM cDNA ORF Clone, Mouse, C-His tag MG50005-CH
    CD166 / ALCAM cDNA ORF Clone, Mouse, N-His tag MG50005-NH
    CD166 / ALCAM cDNA ORF Clone, Mouse, C-HA tag MG50005-CY
    CD166 / ALCAM cDNA ORF Clone, Mouse, N-HA tag MG50005-NY
    CD166 / ALCAM cDNA ORF Clone, Mouse, C-Myc tag MG50005-CM
    CD166 / ALCAM cDNA ORF Clone, Mouse, N-Myc tag MG50005-NM
    CD166 / ALCAM qPCR Primer Pairs, Mouse MP200005

    CD166 / ALCAM cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD166 / ALCAM cDNA ORF Clone in Cloning Vector, Human HG10045-M
    CD166 / ALCAM cDNA ORF Clone, Human, untagged HG10045-UT
    CD166 / ALCAM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10045-ACGLN
    CD166 / ALCAM cDNA ORF Clone, Human, C-GFPSpark® tag HG10045-ACG
    CD166 / ALCAM cDNA ORF Clone, Human, C-OFPSpark® tag HG10045-ACR
    CD166 / ALCAM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10045-CF
    CD166 / ALCAM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10045-NF
    CD166 / ALCAM cDNA ORF Clone, Human, C-His tag HG10045-CH
    CD166 / ALCAM cDNA ORF Clone, Human, N-His tag HG10045-NH
    CD166 / ALCAM cDNA ORF Clone, Human, C-HA tag HG10045-CY
    CD166 / ALCAM cDNA ORF Clone, Human, N-HA tag HG10045-NY
    CD166 / ALCAM cDNA ORF Clone, Human, C-Myc tag HG10045-CM
    CD166 / ALCAM cDNA ORF Clone, Human, N-Myc tag HG10045-NM
    CD166 / ALCAM qPCR Primer Pairs, Human HP100050
    info info
    添加购物车成功! 添加购物车失败!