Adenylate Kinase 1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80583-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Adenylate Kinase 1 Reagents
CRO Services
Product recommended

All Adenylate Kinase 1 Reagents
Adenylate Kinase 1 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Rat adenylate kinase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adenylate Kinase 1 Background Information
Full Name
adenylate kinase 1
References
  • Lu Q, et al. (1996) Adenylate kinase complements nucleoside diphosphate kinase deficiency in nucleotide metabolism. Proc Natl Acad Sci. 93 (12): 5720-5.
  • Dzeja P, et al. (2009) Adenylate kinase and AMP signaling networks: Metabolic monitoring, signal communication and body energy sensing. Int J Mol Sci. 10 (4): 1729-72.
  • Lagresle-Peyrou C, et al. (2008) Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature Genetics. 41: 106 - 11.
  • Adenylate Kinase 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Adenylate Kinase 1 cDNA ORF Clone in Cloning Vector, Rat RG80583-U
    Adenylate Kinase 1 cDNA ORF Clone, Rat, untagged RG80583-UT
    Adenylate Kinase 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80583-ACGLN
    Adenylate Kinase 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80583-ACG
    Adenylate Kinase 1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80583-ANG
    Adenylate Kinase 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80583-ACR
    Adenylate Kinase 1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80583-ANR
    Adenylate Kinase 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80583-CF
    Adenylate Kinase 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80583-NF
    Adenylate Kinase 1 cDNA ORF Clone, Rat, C-His tag RG80583-CH
    Adenylate Kinase 1 cDNA ORF Clone, Rat, C-HA tag RG80583-CY
    Adenylate Kinase 1 cDNA ORF Clone, Rat, N-HA tag RG80583-NY
    Adenylate Kinase 1 cDNA ORF Clone, Rat, C-Myc tag RG80583-CM
    Adenylate Kinase 1 cDNA ORF Clone, Rat, N-Myc tag RG80583-NM
    Adenylate Kinase 1 qPCR Primer Pairs, Rat RP300547

    Adenylate Kinase 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Adenylate Kinase 1 cDNA ORF Clone in Cloning Vector, Mouse MG53710-U
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, untagged MG53710-UT
    Adenylate Kinase 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53710-ACGLN
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53710-ACG
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53710-ANG
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53710-ACR
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53710-ANR
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53710-CF
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53710-NF
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, C-His tag MG53710-CH
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, N-His tag MG53710-NH
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, C-HA tag MG53710-CY
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, N-HA tag MG53710-NY
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, C-Myc tag MG53710-CM
    Adenylate Kinase 1 cDNA ORF Clone, Mouse, N-Myc tag MG53710-NM

    Adenylate Kinase 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Adenylate Kinase 1 cDNA ORF Clone, Human, untagged HG12442-UT
    Adenylate Kinase 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12442-ACGLN
    Adenylate Kinase 1 qPCR Primer Pairs, Human HP104783
    info info
    添加购物车成功! 添加购物车失败!