AGTRAP cDNA ORF Clone, Rat, N-HA tag

Cat: RG80762-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGTRAP Reagents
CRO Services
Product recommended

All AGTRAP Reagents
AGTRAP cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
483 bp
Description
Full length Clone DNA of Rat angiotensin II receptor-associated protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGTRAP Background Information
Full Name
angiotensin II receptor-associated protein

AGTRAP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AGTRAP cDNA ORF Clone in Cloning Vector, Rat RG80762-U
AGTRAP cDNA ORF Clone, Rat, untagged RG80762-UT
AGTRAP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80762-ACG
AGTRAP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80762-ACGLN
AGTRAP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80762-ACR
AGTRAP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80762-CF
AGTRAP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80762-NF
AGTRAP cDNA ORF Clone, Rat, C-His tag RG80762-CH
AGTRAP cDNA ORF Clone, Rat, N-His tag RG80762-NH
AGTRAP cDNA ORF Clone, Rat, C-HA tag RG80762-CY
AGTRAP cDNA ORF Clone, Rat, C-Myc tag RG80762-CM
AGTRAP cDNA ORF Clone, Rat, N-Myc tag RG80762-NM
AGTRAP qPCR Primer Pairs, Rat RP300726

AGTRAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AGTRAP cDNA ORF Clone in Cloning Vector, Mouse MG53324-U
AGTRAP cDNA ORF Clone, Mouse, untagged MG53324-UT
AGTRAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53324-ACGLN
AGTRAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53324-ACG
AGTRAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53324-ANG
AGTRAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53324-ACR
AGTRAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53324-ANR
AGTRAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53324-CF
AGTRAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53324-NF
AGTRAP cDNA ORF Clone, Mouse, C-His tag MG53324-CH
AGTRAP cDNA ORF Clone, Mouse, N-His tag MG53324-NH
AGTRAP cDNA ORF Clone, Mouse, C-HA tag MG53324-CY
AGTRAP cDNA ORF Clone, Mouse, N-HA tag MG53324-NY
AGTRAP cDNA ORF Clone, Mouse, C-Myc tag MG53324-CM
AGTRAP cDNA ORF Clone, Mouse, N-Myc tag MG53324-NM

AGTRAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGTRAP cDNA ORF Clone in Cloning Vector, Human HG14157-G
AGTRAP cDNA ORF Clone, Human, untagged HG14157-UT
AGTRAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14157-ACGLN
AGTRAP cDNA ORF Clone, Human, C-GFPSpark® tag HG14157-ACG
AGTRAP cDNA ORF Clone, Human, C-OFPSpark® tag HG14157-ACR
AGTRAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14157-CF
AGTRAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14157-NF
AGTRAP cDNA ORF Clone, Human, C-His tag HG14157-CH
AGTRAP cDNA ORF Clone, Human, N-His tag HG14157-NH
AGTRAP cDNA ORF Clone, Human, C-HA tag HG14157-CY
AGTRAP cDNA ORF Clone, Human, N-HA tag HG14157-NY
AGTRAP cDNA ORF Clone, Human, C-Myc tag HG14157-CM
AGTRAP cDNA ORF Clone, Human, N-Myc tag HG14157-NM
AGTRAP qPCR Primer Pairs, Human HP102808
info info
添加购物车成功! 添加购物车失败!