AGR2 cDNA ORF Clone, Rat, untagged

Cat: RG81285-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGR2 Reagents
CRO Services
Product recommended

All AGR2 Reagents
AGR2 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Rat anterior gradient 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGR2 Background Information
Full Name
anterior gradient 2

AGR2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AGR2 cDNA ORF Clone in Cloning Vector, Rat RG81285-U
AGR2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81285-ACG
AGR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81285-ACGLN
AGR2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81285-ACR
AGR2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81285-CF
AGR2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81285-NF
AGR2 cDNA ORF Clone, Rat, C-His tag RG81285-CH
AGR2 cDNA ORF Clone, Rat, N-His tag RG81285-NH
AGR2 cDNA ORF Clone, Rat, C-HA tag RG81285-CY
AGR2 cDNA ORF Clone, Rat, N-HA tag RG81285-NY
AGR2 cDNA ORF Clone, Rat, C-Myc tag RG81285-CM
AGR2 cDNA ORF Clone, Rat, N-Myc tag RG81285-NM
AGR2 qPCR Primer Pairs, Rat RP301241

AGR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AGR2 cDNA ORF Clone in Cloning Vector, Human HG11999-G
AGR2 cDNA ORF Clone, Human, untagged HG11999-UT
AGR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11999-ACG
AGR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11999-ACGLN
AGR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11999-ACR
AGR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11999-G-F
AGR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11999-CF
AGR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11999-NF
AGR2 cDNA ORF Clone, Human, C-His tag HG11999-CH
AGR2 cDNA ORF Clone, Human, N-His tag HG11999-NH
AGR2 cDNA ORF Clone, Human, C-HA tag HG11999-CY
AGR2 cDNA ORF Clone, Human, N-HA tag HG11999-NY
AGR2 cDNA ORF Clone, Human, C-Myc tag HG11999-CM
AGR2 cDNA ORF Clone, Human, N-Myc tag HG11999-NM
AGR2 qPCR Primer Pairs, Human HP101537
info info
添加购物车成功! 添加购物车失败!