ADTRP cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81261-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADTRP Reagents
CRO Services
Product recommended

All ADTRP Reagents
ADTRP cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
693 bp
Description
Full length Clone DNA of Rat androgen-dependent TFPI-regulating protein with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADTRP Background Information
Full Name
androgen-dependent TFPI-regulating protein

ADTRP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ADTRP cDNA ORF Clone in Cloning Vector, Rat RG81261-U
ADTRP cDNA ORF Clone, Rat, untagged RG81261-UT
ADTRP cDNA ORF Clone, Rat, C-GFPSpark® tag RG81261-ACG
ADTRP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81261-ACGLN
ADTRP cDNA ORF Clone, Rat, C-OFPSpark® tag RG81261-ACR
ADTRP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81261-NF
ADTRP cDNA ORF Clone, Rat, C-His tag RG81261-CH
ADTRP cDNA ORF Clone, Rat, N-His tag RG81261-NH
ADTRP cDNA ORF Clone, Rat, C-HA tag RG81261-CY
ADTRP cDNA ORF Clone, Rat, N-HA tag RG81261-NY
ADTRP cDNA ORF Clone, Rat, C-Myc tag RG81261-CM
ADTRP cDNA ORF Clone, Rat, N-Myc tag RG81261-NM
ADTRP qPCR Primer Pairs, Rat RP301217

ADTRP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADTRP cDNA ORF Clone in Cloning Vector, Mouse MG55870-U
ADTRP cDNA ORF Clone, Mouse, untagged MG55870-UT
ADTRP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55870-ACGLN
ADTRP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55870-ACG
ADTRP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55870-ANG
ADTRP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55870-ACR
ADTRP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55870-ANR
ADTRP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55870-CF
ADTRP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55870-NF
ADTRP cDNA ORF Clone, Mouse, C-His tag MG55870-CH
ADTRP cDNA ORF Clone, Mouse, N-His tag MG55870-NH
ADTRP cDNA ORF Clone, Mouse, C-HA tag MG55870-CY
ADTRP cDNA ORF Clone, Mouse, N-HA tag MG55870-NY
ADTRP cDNA ORF Clone, Mouse, C-Myc tag MG55870-CM
ADTRP cDNA ORF Clone, Mouse, N-Myc tag MG55870-NM
info info
添加购物车成功! 添加购物车失败!