Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81324-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Adenylosuccinate Lyase Reagents
CRO Services
Product recommended

All Adenylosuccinate Lyase Reagents
Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1455 bp
Description
Full length Clone DNA of Rat adenylosuccinate lyase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adenylosuccinate Lyase Background Information

Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of adenylosuccinat converting to AMP and fumarate as part of the purine nucleotide cycle. The two substates of adenylosuccinate lyase (ADSL) are dephosphorylated derivatives of SAICA ribotide (SAICAR) and adenylosuccinate (S-AMP), which catalyzes an important reaction in the de novo pathway of purine biosynthesis. ADSL catalyzes two distinct reactions in the synthesis of purine nucleotides, both of which involve the _-elimination of fumarate to produce either aminoimidazole carboxamide ribotide from SAICAR or AMP from S-AMP. The Adenylosuccinate lyase deficiency is a rare autosomal recessive metabolic disorder characterized by the present of SAICA riboside and succinyladenosine (S-Ado). ADSL defect in different patients is often caused by different mutations to the enzyme.

Full Name
adenylosuccinate lyase
References
  • Nassogne M, et al. (2000) Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain and development. 22 (6): 383-6.
  • Sivendran S, et al. (2004) Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 279 (51): 53789-97.
  • Lee TT, et al. (1999) His68 and His141 are critical contributors to the intersubunit catalytic site of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 38 (1): 22-32.
  • Adenylosuccinate Lyase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Adenylosuccinate Lyase cDNA ORF Clone in Cloning Vector, Rat RG81324-G
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, untagged RG81324-UT
    Adenylosuccinate Lyase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81324-ACGLN
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81324-ACG
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81324-ANG
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81324-ACR
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81324-ANR
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81324-CF
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, C-His tag RG81324-CH
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-His tag RG81324-NH
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, C-HA tag RG81324-CY
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-HA tag RG81324-NY
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, C-Myc tag RG81324-CM
    Adenylosuccinate Lyase cDNA ORF Clone, Rat, N-Myc tag RG81324-NM
    Adenylosuccinate Lyase qPCR Primer Pairs, Rat RP301295

    Adenylosuccinate Lyase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Adenylosuccinate Lyase cDNA ORF Clone in Cloning Vector, Human HG11287-M
    Adenylosuccinate Lyase cDNA ORF Clone, Human, untagged HG11287-UT
    Adenylosuccinate Lyase cDNA ORF Clone, Human, C-GFPSpark® tag HG11287-ACG
    Adenylosuccinate Lyase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11287-ACGLN
    Adenylosuccinate Lyase cDNA ORF Clone, Human, N-GFPSpark® tag HG11287-ANG
    Adenylosuccinate Lyase cDNA ORF Clone, Human, C-OFPSpark® tag HG11287-ACR
    Adenylosuccinate Lyase cDNA ORF Clone, Human, N-OFPSpark® tag HG11287-ANR
    Adenylosuccinate Lyase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11287-CF
    Adenylosuccinate Lyase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11287-NF
    Adenylosuccinate Lyase cDNA ORF Clone, Human, C-His tag HG11287-CH
    Adenylosuccinate Lyase cDNA ORF Clone, Human, N-His tag HG11287-NH
    Adenylosuccinate Lyase cDNA ORF Clone, Human, C-HA tag HG11287-CY
    Adenylosuccinate Lyase cDNA ORF Clone, Human, N-HA tag HG11287-NY
    Adenylosuccinate Lyase cDNA ORF Clone, Human, C-Myc tag HG11287-CM
    Adenylosuccinate Lyase cDNA ORF Clone, Human, N-Myc tag HG11287-NM
    Adenylosuccinate Lyase qPCR Primer Pairs, Human HP101165
    info info
    添加购物车成功! 添加购物车失败!