After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat ADH5 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat ADH5 cDNA Clone Product Information
NCBI RefSeq:NM_001126120.1
RefSeq ORF Size:1125bp
cDNA Description:Full length Clone DNA of Rattus norvegicus alcohol dehydrogenase 5 (class III), chi polypeptide.
Gene Synonym:Adh5
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Carbonic anhydrases IX (CAIX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide ( H2O + CO2 = H+ + HCO3- ) and thus participate in a variety of biological and physical processes. CAIX is a transmembrane protein structurally consisting of a signal peptide, a proteoglycan-related region, a CA domain with a highly conserved active site, a transmembrane anchor and an intracytoplasmic tail, and is the only tumor-associated CA isoenzyme known so far. Compared with normal tissues, CAIX is overexpressed in a wide spectrum of tumor types and associated with increased metastasis and poor prognosis in aggressive carcinomas. CAIX expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. CA9 is regarded as a new therapeutic target for CA9-derived carcinomas.

References
  • Pastorek, J. et al., 1994, Oncogene. 9: 2877-88.
  • Opavsky, R. et al., 1996, Genomics. 33: 480-7.
  • Swietach, P. et al., 2008, J. Biol. Chem. 283: 20473-83.
  • Robertson, N. et al., 2004, Cancer. Res. 64: 6160-5.
  • Bui, M.H. et al., 2003, Clin. Cancer. Res. 9: 802-11.
  • Choi, S.W. et al., 2008, Hum. Pathol. 39: 1317-22.
  • Size / Price
    Catalog: RG81124-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"