Gamma 2 actin cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81257-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Gamma 2 actin Reagents
CRO Services
Product recommended

All Gamma 2 actin Reagents
Gamma 2 actin cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1131 bp
Description
Full length Clone DNA of Rat actin, gamma 2, smooth muscle, enteric with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Gamma 2 actin Background Information
Full Name
actin, gamma 2, smooth muscle, enteric

Gamma 2 actin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Gamma 2 actin cDNA ORF Clone in Cloning Vector, Rat RG81257-U
Gamma 2 actin cDNA ORF Clone, Rat, untagged RG81257-UT
Gamma 2 actin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81257-ACG
Gamma 2 actin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81257-ACGLN
Gamma 2 actin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81257-ANG
Gamma 2 actin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81257-ACR
Gamma 2 actin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81257-ANR
Gamma 2 actin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81257-NF
Gamma 2 actin cDNA ORF Clone, Rat, C-His tag RG81257-CH
Gamma 2 actin cDNA ORF Clone, Rat, N-His tag RG81257-NH
Gamma 2 actin cDNA ORF Clone, Rat, C-HA tag RG81257-CY
Gamma 2 actin cDNA ORF Clone, Rat, N-HA tag RG81257-NY
Gamma 2 actin cDNA ORF Clone, Rat, C-Myc tag RG81257-CM
Gamma 2 actin cDNA ORF Clone, Rat, N-Myc tag RG81257-NM
Gamma 2 actin qPCR Primer Pairs, Rat RP301213

Gamma 2 actin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Gamma 2 actin cDNA ORF Clone in Cloning Vector, Mouse MG59713-U
Gamma 2 actin cDNA ORF Clone, Mouse, untagged MG59713-UT
Gamma 2 actin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59713-ACG
Gamma 2 actin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59713-ACGLN
Gamma 2 actin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59713-ANG
Gamma 2 actin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59713-ACR
Gamma 2 actin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59713-ANR
Gamma 2 actin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59713-CF
Gamma 2 actin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59713-NF
Gamma 2 actin cDNA ORF Clone, Mouse, C-His tag MG59713-CH
Gamma 2 actin cDNA ORF Clone, Mouse, N-His tag MG59713-NH
Gamma 2 actin cDNA ORF Clone, Mouse, C-HA tag MG59713-CY
Gamma 2 actin cDNA ORF Clone, Mouse, N-HA tag MG59713-NY
Gamma 2 actin cDNA ORF Clone, Mouse, C-Myc tag MG59713-CM
Gamma 2 actin cDNA ORF Clone, Mouse, N-Myc tag MG59713-NM

Gamma 2 actin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Gamma 2 actin cDNA ORF Clone in Cloning Vector, Human HG10961-M
Gamma 2 actin cDNA ORF Clone, Human, untagged HG10961-UT
Gamma 2 actin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10961-ACGLN
Gamma 2 actin cDNA ORF Clone, Human, C-GFPSpark® tag HG10961-ACG
Gamma 2 actin cDNA ORF Clone, Human, N-GFPSpark® tag HG10961-ANG
Gamma 2 actin cDNA ORF Clone, Human, C-OFPSpark® tag HG10961-ACR
Gamma 2 actin cDNA ORF Clone, Human, N-OFPSpark® tag HG10961-ANR
Gamma 2 actin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10961-CF
Gamma 2 actin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10961-NF
Gamma 2 actin cDNA ORF Clone, Human, C-His tag HG10961-CH
Gamma 2 actin cDNA ORF Clone, Human, N-His tag HG10961-NH
Gamma 2 actin cDNA ORF Clone, Human, C-HA tag HG10961-CY
Gamma 2 actin cDNA ORF Clone, Human, N-HA tag HG10961-NY
Gamma 2 actin cDNA ORF Clone, Human, C-Myc tag HG10961-CM
Gamma 2 actin cDNA ORF Clone, Human, N-Myc tag HG10961-NM
Gamma 2 actin qPCR Primer Pairs, Human HP100837
info info
添加购物车成功! 添加购物车失败!