beta-Actin cDNA ORF Clone, Rat, untagged

Cat: RG81089-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All beta-Actin Reagents
CRO Services
Product recommended

All beta-Actin Reagents
beta-Actin cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Description
Full length Clone DNA of Rat actin, beta.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta-Actin Background Information
Full Name
actin, beta

beta-Actin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Rat RG81089-U
beta-Actin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81089-ACGLN
beta-Actin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81089-ACG
beta-Actin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81089-ANG
beta-Actin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81089-ACR
beta-Actin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81089-ANR
beta-Actin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81089-CF
beta-Actin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81089-NF
beta-Actin cDNA ORF Clone, Rat, C-His tag RG81089-CH
beta-Actin cDNA ORF Clone, Rat, N-His tag RG81089-NH
beta-Actin cDNA ORF Clone, Rat, C-HA tag RG81089-CY
beta-Actin cDNA ORF Clone, Rat, N-HA tag RG81089-NY
beta-Actin cDNA ORF Clone, Rat, C-Myc tag RG81089-CM
beta-Actin cDNA ORF Clone, Rat, N-Myc tag RG81089-NM
beta-Actin qPCR Primer Pairs, Rat RP301046

beta-Actin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Mouse MG57265-U
beta-Actin cDNA ORF Clone, Mouse, untagged MG57265-UT
beta-Actin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57265-ACGLN
beta-Actin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57265-ACG
beta-Actin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57265-ANG
beta-Actin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57265-ACR
beta-Actin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57265-ANR
beta-Actin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57265-CF
beta-Actin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57265-NF
beta-Actin cDNA ORF Clone, Mouse, C-His tag MG57265-CH
beta-Actin cDNA ORF Clone, Mouse, N-His tag MG57265-NH
beta-Actin cDNA ORF Clone, Mouse, C-HA tag MG57265-CY
beta-Actin cDNA ORF Clone, Mouse, N-HA tag MG57265-NY
beta-Actin cDNA ORF Clone, Mouse, C-Myc tag MG57265-CM
beta-Actin cDNA ORF Clone, Mouse, N-Myc tag MG57265-NM

beta-Actin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Human HG10962-M
beta-Actin cDNA ORF Clone, Human, untagged HG10962-UT
beta-Actin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10962-ACGLN
beta-Actin cDNA ORF Clone, Human, C-GFPSpark® tag HG10962-ACG
beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag HG10962-ANG
beta-Actin cDNA ORF Clone, Human, C-OFPSpark® tag HG10962-ACR
beta-Actin cDNA ORF Clone, Human, N-OFPSpark® tag HG10962-ANR
beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10962-CF
beta-Actin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10962-NF
beta-Actin cDNA ORF Clone, Human, C-His tag HG10962-CH
beta-Actin cDNA ORF Clone, Human, N-His tag HG10962-NH
beta-Actin cDNA ORF Clone, Human, C-HA tag HG10962-CY
beta-Actin cDNA ORF Clone, Human, N-HA tag HG10962-NY
beta-Actin cDNA ORF Clone, Human, C-Myc tag HG10962-CM
beta-Actin cDNA ORF Clone, Human, N-Myc tag HG10962-NM
beta-Actin qPCR Primer Pairs, Human HP100001
info info
添加购物车成功! 添加购物车失败!