ACSM1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80854-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACSM1 Reagents
CRO Services
Product recommended

All ACSM1 Reagents
ACSM1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1734 bp
Description
Full length Clone DNA of Rat acyl-CoA synthetase medium-chain family member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACSM1 Background Information
Full Name
acyl-CoA synthetase medium-chain family member 1

ACSM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACSM1 cDNA ORF Clone in Cloning Vector, Rat RG80854-U
ACSM1 cDNA ORF Clone, Rat, untagged RG80854-UT
ACSM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80854-ACG
ACSM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80854-ACGLN
ACSM1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80854-ANG
ACSM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80854-ACR
ACSM1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80854-ANR
ACSM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80854-CF
ACSM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80854-NF
ACSM1 cDNA ORF Clone, Rat, C-His tag RG80854-CH
ACSM1 cDNA ORF Clone, Rat, N-His tag RG80854-NH
ACSM1 cDNA ORF Clone, Rat, C-HA tag RG80854-CY
ACSM1 cDNA ORF Clone, Rat, N-HA tag RG80854-NY
ACSM1 cDNA ORF Clone, Rat, C-Myc tag RG80854-CM
ACSM1 qPCR Primer Pairs, Rat RP300818

ACSM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACSM1 cDNA ORF Clone in Cloning Vector, Mouse MG5A5711-U
ACSM1 cDNA ORF Clone, Mouse, untagged MG5A5711-UT
ACSM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5711-ACG
ACSM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5711-ACGLN
ACSM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5711-ANG
ACSM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5711-ACR
ACSM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5711-ANR
ACSM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5711-CF
ACSM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5711-NF
ACSM1 cDNA ORF Clone, Mouse, C-His tag MG5A5711-CH
ACSM1 cDNA ORF Clone, Mouse, N-His tag MG5A5711-NH
ACSM1 cDNA ORF Clone, Mouse, C-HA tag MG5A5711-CY
ACSM1 cDNA ORF Clone, Mouse, N-HA tag MG5A5711-NY
ACSM1 cDNA ORF Clone, Mouse, C-Myc tag MG5A5711-CM
ACSM1 cDNA ORF Clone, Mouse, N-Myc tag MG5A5711-NM
info info
添加购物车成功! 添加购物车失败!