ACE cDNA ORF Clone, Rat, C-His tag

Cat: RG80406-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACE Reagents
CRO Services
Product recommended

All ACE Reagents
ACE cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3942 bp
Description
Full length Clone DNA of Rat angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACE Background Information
Full Name
angiotensin I converting enzyme

ACE cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACE cDNA ORF Clone in Cloning Vector, Rat RG80406-G
ACE cDNA ORF Clone, Rat, untagged RG80406-UT
ACE Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80406-ACGLN
ACE cDNA ORF Clone, Rat, C-GFPSpark® tag RG80406-ACG
ACE cDNA ORF Clone, Rat, C-OFPSpark® tag RG80406-ACR
ACE cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80406-CF
ACE cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80406-NF
ACE cDNA ORF Clone, Rat, N-His tag RG80406-NH
ACE cDNA ORF Clone, Rat, C-HA tag RG80406-CY
ACE cDNA ORF Clone, Rat, N-HA tag RG80406-NY
ACE cDNA ORF Clone, Rat, C-Myc tag RG80406-CM
ACE cDNA ORF Clone, Rat, N-Myc tag RG80406-NM
ACE qPCR Primer Pairs, Rat RP300370

ACE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACE cDNA ORF Clone in Cloning Vector, Human HG11598-M
ACE cDNA ORF Clone, Human, untagged HG11598-UT
ACE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11598-ACGLN
ACE cDNA ORF Clone, Human, C-GFPSpark® tag HG11598-ACG
ACE cDNA ORF Clone, Human, C-OFPSpark® tag HG11598-ACR
ACE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11598-CF
ACE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11598-NF
ACE cDNA ORF Clone, Human, C-His tag HG11598-CH
ACE cDNA ORF Clone, Human, N-His tag HG11598-NH
ACE cDNA ORF Clone, Human, C-HA tag HG11598-CY
ACE cDNA ORF Clone, Human, N-HA tag HG11598-NY
ACE cDNA ORF Clone, Human, C-Myc tag HG11598-CM
ACE cDNA ORF Clone, Human, N-Myc tag HG11598-NM
ACE qPCR Primer Pairs, Human HP101461
info info
添加购物车成功! 添加购物车失败!