ACAT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81212-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ACAT1 Reagents
CRO Services
Product recommended

All ACAT1 Reagents
ACAT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 90T/C,507G/A,855T/C,898A/C, not causing the amino acid variation.
Description
Full length Clone DNA of Rat acetyl-CoA acetyltransferase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.31kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ACAT1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACAT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
ACAT1 Background Information
Full Name
acetyl-CoA acetyltransferase 1

ACAT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ACAT1 cDNA ORF Clone in Cloning Vector, Rat RG81212-U
ACAT1 cDNA ORF Clone, Rat, untagged RG81212-UT
ACAT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81212-ACGLN
ACAT1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81212-ACG
ACAT1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81212-ANG
ACAT1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81212-ACR
ACAT1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81212-ANR
ACAT1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81212-NF
ACAT1 cDNA ORF Clone, Rat, C-His tag RG81212-CH
ACAT1 cDNA ORF Clone, Rat, N-His tag RG81212-NH
ACAT1 cDNA ORF Clone, Rat, C-HA tag RG81212-CY
ACAT1 cDNA ORF Clone, Rat, N-HA tag RG81212-NY
ACAT1 cDNA ORF Clone, Rat, C-Myc tag RG81212-CM
ACAT1 cDNA ORF Clone, Rat, N-Myc tag RG81212-NM
ACAT1 qPCR Primer Pairs, Rat RP301168

ACAT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACAT1 cDNA ORF Clone in Cloning Vector, Mouse MG52278-G
ACAT1 cDNA ORF Clone, Mouse, untagged MG52278-UT
ACAT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52278-ACG
ACAT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52278-ACGLN
ACAT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52278-ANG
ACAT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52278-ACR
ACAT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52278-ANR
ACAT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52278-CF
ACAT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52278-NF
ACAT1 cDNA ORF Clone, Mouse, C-His tag MG52278-CH
ACAT1 cDNA ORF Clone, Mouse, N-His tag MG52278-NH
ACAT1 cDNA ORF Clone, Mouse, C-HA tag MG52278-CY
ACAT1 cDNA ORF Clone, Mouse, N-HA tag MG52278-NY
ACAT1 cDNA ORF Clone, Mouse, C-Myc tag MG52278-CM
ACAT1 cDNA ORF Clone, Mouse, N-Myc tag MG52278-NM
ACAT1 qPCR Primer Pairs, Mouse MP202151

ACAT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACAT1 cDNA ORF Clone, Human, untagged HG18077-UT
info info
添加购物车成功! 添加购物车失败!