AAMP cDNA ORF Clone, Rat, untagged

Cat: RG81208-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AAMP Reagents
CRO Services
Product recommended

All AAMP Reagents
AAMP cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Description
Full length Clone DNA of Rat angio-associated, migratory cell protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AAMP Background Information
Full Name
angio-associated, migratory cell protein

AAMP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AAMP cDNA ORF Clone in Cloning Vector, Rat RG81208-U
AAMP cDNA ORF Clone, Rat, C-GFPSpark® tag RG81208-ACG
AAMP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81208-ACGLN
AAMP cDNA ORF Clone, Rat, C-OFPSpark® tag RG81208-ACR
AAMP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81208-CF
AAMP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81208-NF
AAMP cDNA ORF Clone, Rat, C-His tag RG81208-CH
AAMP cDNA ORF Clone, Rat, N-His tag RG81208-NH
AAMP cDNA ORF Clone, Rat, C-HA tag RG81208-CY
AAMP cDNA ORF Clone, Rat, N-HA tag RG81208-NY
AAMP cDNA ORF Clone, Rat, C-Myc tag RG81208-CM
AAMP cDNA ORF Clone, Rat, N-Myc tag RG81208-NM
AAMP qPCR Primer Pairs, Rat RP301164

AAMP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AAMP cDNA ORF Clone in Cloning Vector, Mouse MG50222-G
AAMP cDNA ORF Clone, Mouse, untagged MG50222-UT
AAMP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50222-ACG
AAMP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50222-ACGLN
AAMP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50222-ANG
AAMP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50222-ACR
AAMP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50222-ANR
AAMP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50222-CF
AAMP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50222-NF
AAMP cDNA ORF Clone, Mouse, C-His tag MG50222-CH
AAMP cDNA ORF Clone, Mouse, N-His tag MG50222-NH
AAMP cDNA ORF Clone, Mouse, C-HA tag MG50222-CY
AAMP cDNA ORF Clone, Mouse, N-HA tag MG50222-NY
AAMP cDNA ORF Clone, Mouse, C-Myc tag MG50222-CM
AAMP cDNA ORF Clone, Mouse, N-Myc tag MG50222-NM
AAMP qPCR Primer Pairs, Mouse MP200249

AAMP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AAMP cDNA ORF Clone in Cloning Vector, Human HG10964-M
AAMP cDNA ORF Clone, Human, untagged HG10964-UT
AAMP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10964-ACGLN
AAMP cDNA ORF Clone, Human, C-GFPSpark® tag HG10964-ACG
AAMP cDNA ORF Clone, Human, C-OFPSpark® tag HG10964-ACR
AAMP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10964-CF
AAMP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10964-NF
AAMP cDNA ORF Clone, Human, C-His tag HG10964-CH
AAMP cDNA ORF Clone, Human, N-His tag HG10964-NH
AAMP cDNA ORF Clone, Human, C-HA tag HG10964-CY
AAMP cDNA ORF Clone, Human, N-HA tag HG10964-NY
AAMP cDNA ORF Clone, Human, C-Myc tag HG10964-CM
AAMP cDNA ORF Clone, Human, N-Myc tag HG10964-NM
AAMP qPCR Primer Pairs, Human HP100839
info info
添加购物车成功! 添加购物车失败!