ZDHHC6 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65081-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZDHHC6 Reagents
CRO Services
Product recommended

All ZDHHC6 Reagents
ZDHHC6 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1242 bp
Description
Full length Clone DNA of Rabbit zinc finger, DHHC-type containing 6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZDHHC6 Background Information
Full Name
zinc finger, DHHC-type containing 6

ZDHHC6 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
ZDHHC6 cDNA ORF Clone in Cloning Vector, Rabbit TG65081-G
ZDHHC6 cDNA ORF Clone, Rabbit, untagged TG65081-UT
ZDHHC6 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65081-ACGLN
ZDHHC6 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65081-ACG
ZDHHC6 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65081-ANG
ZDHHC6 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65081-ACR
ZDHHC6 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65081-ANR
ZDHHC6 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65081-CF
ZDHHC6 cDNA ORF Clone, Rabbit, C-His tag TG65081-CH
ZDHHC6 cDNA ORF Clone, Rabbit, N-His tag TG65081-NH
ZDHHC6 cDNA ORF Clone, Rabbit, C-HA tag TG65081-CY
ZDHHC6 cDNA ORF Clone, Rabbit, N-HA tag TG65081-NY
ZDHHC6 cDNA ORF Clone, Rabbit, C-Myc tag TG65081-CM
ZDHHC6 cDNA ORF Clone, Rabbit, N-Myc tag TG65081-NM

ZDHHC6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZDHHC6 cDNA ORF Clone in Cloning Vector, Mouse MG53691-U
ZDHHC6 cDNA ORF Clone, Mouse, untagged MG53691-UT
ZDHHC6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53691-ACG
ZDHHC6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53691-ACGLN
ZDHHC6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53691-ANG
ZDHHC6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53691-ACR
ZDHHC6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53691-ANR
ZDHHC6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53691-CF
ZDHHC6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53691-NF
ZDHHC6 cDNA ORF Clone, Mouse, C-His tag MG53691-CH
ZDHHC6 cDNA ORF Clone, Mouse, N-His tag MG53691-NH
ZDHHC6 cDNA ORF Clone, Mouse, C-HA tag MG53691-CY
ZDHHC6 cDNA ORF Clone, Mouse, N-HA tag MG53691-NY
ZDHHC6 cDNA ORF Clone, Mouse, C-Myc tag MG53691-CM
ZDHHC6 cDNA ORF Clone, Mouse, N-Myc tag MG53691-NM
info info
添加购物车成功! 添加购物车失败!