PLP1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag

Cat: TG65054-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLP1 Reagents
CRO Services
Product recommended

All PLP1 Reagents
PLP1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Rabbit proteolipid protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLP1 Background Information
Full Name
proteolipid protein 1

PLP1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PLP1 cDNA ORF Clone in Cloning Vector, Canine DG70129-U

PLP1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PLP1 cDNA ORF Clone in Cloning Vector, Rabbit TG65054-G
PLP1 cDNA ORF Clone, Rabbit, untagged TG65054-UT
PLP1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65054-ACG
PLP1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65054-ACGLN
PLP1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65054-ANG
PLP1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65054-ACR
PLP1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65054-ANR
PLP1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65054-NF
PLP1 cDNA ORF Clone, Rabbit, C-His tag TG65054-CH
PLP1 cDNA ORF Clone, Rabbit, N-His tag TG65054-NH
PLP1 cDNA ORF Clone, Rabbit, C-HA tag TG65054-CY
PLP1 cDNA ORF Clone, Rabbit, N-HA tag TG65054-NY
PLP1 cDNA ORF Clone, Rabbit, C-Myc tag TG65054-CM
PLP1 cDNA ORF Clone, Rabbit, N-Myc tag TG65054-NM

PLP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PLP1 cDNA ORF Clone in Cloning Vector, Rat RG81498-G

PLP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLP1 cDNA ORF Clone in Cloning Vector, Mouse MG53205-G
PLP1 cDNA ORF Clone, Mouse, untagged MG53205-UT
PLP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53205-ACG
PLP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53205-ACGLN
PLP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53205-ACR
PLP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53205-CF
PLP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53205-NF
PLP1 cDNA ORF Clone, Mouse, C-His tag MG53205-CH
PLP1 cDNA ORF Clone, Mouse, N-His tag MG53205-NH
PLP1 cDNA ORF Clone, Mouse, C-HA tag MG53205-CY
PLP1 cDNA ORF Clone, Mouse, N-HA tag MG53205-NY
PLP1 cDNA ORF Clone, Mouse, C-Myc tag MG53205-CM
PLP1 cDNA ORF Clone, Mouse, N-Myc tag MG53205-NM

PLP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLP1 cDNA ORF Clone in Cloning Vector, Human HG17709-U
PLP1 cDNA ORF Clone, Human, untagged HG17709-UT
PLP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17709-ACG
PLP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17709-ACGLN
PLP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17709-ANG
PLP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17709-ACR
PLP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17709-ANR
PLP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17709-CF
PLP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17709-NF
PLP1 cDNA ORF Clone, Human, C-His tag HG17709-CH
PLP1 cDNA ORF Clone, Human, N-His tag HG17709-NH
PLP1 cDNA ORF Clone, Human, C-HA tag HG17709-CY
PLP1 cDNA ORF Clone, Human, N-HA tag HG17709-NY
PLP1 cDNA ORF Clone, Human, C-Myc tag HG17709-CM
PLP1 cDNA ORF Clone, Human, N-Myc tag HG17709-NM
info info
添加购物车成功! 添加购物车失败!