OLFML3 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag

Cat: TG65029-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OLFML3 Reagents
CRO Services
Product recommended

All OLFML3 Reagents
OLFML3 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1218 bp
Description
Full length Clone DNA of Rabbit olfactomedin-like 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OLFML3 Background Information
Full Name
olfactomedin like 3

OLFML3 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
OLFML3 cDNA ORF Clone in Cloning Vector, Rabbit TG65029-G
OLFML3 cDNA ORF Clone, Rabbit, untagged TG65029-UT
OLFML3 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65029-ACGLN
OLFML3 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65029-ACG
OLFML3 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65029-ACR
OLFML3 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65029-NF
OLFML3 cDNA ORF Clone, Rabbit, C-His tag TG65029-CH
OLFML3 cDNA ORF Clone, Rabbit, N-His tag TG65029-NH
OLFML3 cDNA ORF Clone, Rabbit, C-HA tag TG65029-CY
OLFML3 cDNA ORF Clone, Rabbit, N-HA tag TG65029-NY
OLFML3 cDNA ORF Clone, Rabbit, C-Myc tag TG65029-CM
OLFML3 cDNA ORF Clone, Rabbit, N-Myc tag TG65029-NM

OLFML3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OLFML3 cDNA ORF Clone in Cloning Vector, Mouse MG52020-G
OLFML3 cDNA ORF Clone, Mouse, untagged MG52020-UT
OLFML3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52020-ACGLN
OLFML3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52020-ACG
OLFML3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52020-ACR
OLFML3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52020-CF
OLFML3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52020-NF
OLFML3 cDNA ORF Clone, Mouse, C-His tag MG52020-CH
OLFML3 cDNA ORF Clone, Mouse, N-His tag MG52020-NH
OLFML3 cDNA ORF Clone, Mouse, C-HA tag MG52020-CY
OLFML3 cDNA ORF Clone, Mouse, N-HA tag MG52020-NY
OLFML3 cDNA ORF Clone, Mouse, C-Myc tag MG52020-CM
OLFML3 cDNA ORF Clone, Mouse, N-Myc tag MG52020-NM
OLFML3 qPCR Primer Pairs, Mouse MP201893

OLFML3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OLFML3 cDNA ORF Clone in Cloning Vector, Human HG13267-G
OLFML3 cDNA ORF Clone, Human, untagged HG13267-UT
OLFML3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13267-ACGLN
OLFML3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13267-ACG
OLFML3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13267-ACR
OLFML3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13267-CF
OLFML3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13267-NF
OLFML3 cDNA ORF Clone, Human, C-His tag HG13267-CH
OLFML3 cDNA ORF Clone, Human, N-His tag HG13267-NH
OLFML3 cDNA ORF Clone, Human, C-HA tag HG13267-CY
OLFML3 cDNA ORF Clone, Human, N-HA tag HG13267-NY
OLFML3 cDNA ORF Clone, Human, C-Myc tag HG13267-CM
OLFML3 cDNA ORF Clone, Human, N-Myc tag HG13267-NM
OLFML3 qPCR Primer Pairs, Human HP101976
info info
添加购物车成功! 添加购物车失败!