SPTSSB cDNA ORF Clone, Rabbit, C-Myc tag

Cat: TG65050-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPTSSB Reagents
CRO Services
Product recommended

All SPTSSB Reagents
SPTSSB cDNA ORF Clone, Rabbit, C-Myc tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
231 bp
Description
Full length Clone DNA of Rabbit androgen down regulated in mouse prostate-like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPTSSB Background Information
Full Name
serine palmitoyltransferase, small subunit B

SPTSSB cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
SPTSSB cDNA ORF Clone in Cloning Vector, Rabbit TG65050-G
SPTSSB cDNA ORF Clone in Cloning Vector, Rabbit TG65111-G
SPTSSB cDNA ORF Clone, Rabbit, untagged TG65050-UT
SPTSSB cDNA ORF Clone, Rabbit, untagged TG65111-UT
SPTSSB cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65050-ACG
SPTSSB Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65111-ACGLN
SPTSSB cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65111-ACG
SPTSSB cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65050-ANG
SPTSSB cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65111-ANG
SPTSSB cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65111-ACR
SPTSSB cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65050-ACR
SPTSSB cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65111-ANR
SPTSSB cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65050-ANR
SPTSSB cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65050-CF
SPTSSB cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65111-CF
SPTSSB cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65111-NF
SPTSSB cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65050-NF
SPTSSB cDNA ORF Clone, Rabbit, C-His tag TG65050-CH
SPTSSB cDNA ORF Clone, Rabbit, C-His tag TG65111-CH
SPTSSB cDNA ORF Clone, Rabbit, N-His tag TG65050-NH
SPTSSB cDNA ORF Clone, Rabbit, N-His tag TG65111-NH
SPTSSB cDNA ORF Clone, Rabbit, C-HA tag TG65050-CY
SPTSSB cDNA ORF Clone, Rabbit, C-HA tag TG65111-CY
SPTSSB cDNA ORF Clone, Rabbit, N-HA tag TG65111-NY
SPTSSB cDNA ORF Clone, Rabbit, N-HA tag TG65050-NY
SPTSSB cDNA ORF Clone, Rabbit, C-Myc tag TG65111-CM
SPTSSB cDNA ORF Clone, Rabbit, N-Myc tag TG65111-NM
SPTSSB cDNA ORF Clone, Rabbit, N-Myc tag TG65050-NM

SPTSSB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPTSSB cDNA ORF Clone in Cloning Vector, Mouse MG5A5800-U
SPTSSB cDNA ORF Clone, Mouse, untagged MG5A5800-UT
SPTSSB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5800-ACG
SPTSSB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5800-ACGLN
SPTSSB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5800-ACR
SPTSSB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5800-CF
SPTSSB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5800-NF
SPTSSB cDNA ORF Clone, Mouse, C-His tag MG5A5800-CH
SPTSSB cDNA ORF Clone, Mouse, N-His tag MG5A5800-NH
SPTSSB cDNA ORF Clone, Mouse, C-HA tag MG5A5800-CY
SPTSSB cDNA ORF Clone, Mouse, N-HA tag MG5A5800-NY
SPTSSB cDNA ORF Clone, Mouse, C-Myc tag MG5A5800-CM
SPTSSB cDNA ORF Clone, Mouse, N-Myc tag MG5A5800-NM

SPTSSB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPTSSB cDNA ORF Clone in Cloning Vector, Human HG16210-G
SPTSSB cDNA ORF Clone, Human, untagged HG16210-UT
SPTSSB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16210-ACGLN
SPTSSB cDNA ORF Clone, Human, C-GFPSpark® tag HG16210-ACG
SPTSSB cDNA ORF Clone, Human, C-OFPSpark® tag HG16210-ACR
SPTSSB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16210-CF
SPTSSB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16210-NF
SPTSSB cDNA ORF Clone, Human, C-His tag HG16210-CH
SPTSSB cDNA ORF Clone, Human, N-His tag HG16210-NH
SPTSSB cDNA ORF Clone, Human, C-HA tag HG16210-CY
SPTSSB cDNA ORF Clone, Human, N-HA tag HG16210-NY
SPTSSB cDNA ORF Clone, Human, C-Myc tag HG16210-CM
SPTSSB cDNA ORF Clone, Human, N-Myc tag HG16210-NM
SPTSSB qPCR Primer Pairs, Human HP104975
info info
添加购物车成功! 添加购物车失败!