GPN3 cDNA ORF Clone, Rabbit, C-Myc tag

Cat: TG65036-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPN3 Reagents
CRO Services
Product recommended

All GPN3 Reagents
GPN3 cDNA ORF Clone, Rabbit, C-Myc tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
855 bp
Description
Full length Clone DNA of Rabbit GPN-loop GTPase 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPN3 Background Information
Full Name
GPN-loop GTPase 3

GPN3 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
GPN3 cDNA ORF Clone in Cloning Vector, Rabbit TG65036-G
GPN3 cDNA ORF Clone, Rabbit, untagged TG65036-UT
GPN3 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65036-ACG
GPN3 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65036-ANG
GPN3 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65036-ACR
GPN3 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65036-ANR
GPN3 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65036-CF
GPN3 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65036-NF
GPN3 cDNA ORF Clone, Rabbit, C-His tag TG65036-CH
GPN3 cDNA ORF Clone, Rabbit, N-His tag TG65036-NH
GPN3 cDNA ORF Clone, Rabbit, C-HA tag TG65036-CY
GPN3 cDNA ORF Clone, Rabbit, N-HA tag TG65036-NY
GPN3 cDNA ORF Clone, Rabbit, N-Myc tag TG65036-NM

GPN3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GPN3 cDNA ORF Clone in Cloning Vector, Rat RG8A2844-U
GPN3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A2844-ACGLN

GPN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GPN3 cDNA ORF Clone in Cloning Vector, Mouse MG51662-G
GPN3 cDNA ORF Clone, Mouse, untagged MG51662-UT
GPN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51662-ACGLN
GPN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51662-ACG
GPN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51662-ANG
GPN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51662-ACR
GPN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51662-ANR
GPN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51662-CF
GPN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51662-NF
GPN3 cDNA ORF Clone, Mouse, C-His tag MG51662-CH
GPN3 cDNA ORF Clone, Mouse, N-His tag MG51662-NH
GPN3 cDNA ORF Clone, Mouse, C-HA tag MG51662-CY
GPN3 cDNA ORF Clone, Mouse, N-HA tag MG51662-NY
GPN3 cDNA ORF Clone, Mouse, C-Myc tag MG51662-CM
GPN3 cDNA ORF Clone, Mouse, N-Myc tag MG51662-NM
GPN3 qPCR Primer Pairs, Mouse MP201535
info info
添加购物车成功! 添加购物车失败!