UBE2D3 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65104-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBE2D3 Reagents
CRO Services
Product recommended

All UBE2D3 Reagents
UBE2D3 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Rabbit ubiquitin-conjugating enzyme E2D 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBE2D3 Background Information
Full Name
ubiquitin-conjugating enzyme E2D 3

UBE2D3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
UBE2D3 cDNA ORF Clone in Cloning Vector, Ferret FG60067-G
UBE2D3 cDNA ORF Clone, Ferret, untagged FG60067-UT
UBE2D3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60067-ACGLN
UBE2D3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60067-ACG
UBE2D3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60067-ANG
UBE2D3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60067-ACR
UBE2D3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60067-ANR
UBE2D3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60067-CF
UBE2D3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60067-NF
UBE2D3 cDNA ORF Clone, Ferret, C-His tag FG60067-CH
UBE2D3 cDNA ORF Clone, Ferret, N-His tag FG60067-NH
UBE2D3 cDNA ORF Clone, Ferret, C-HA tag FG60067-CY
UBE2D3 cDNA ORF Clone, Ferret, N-HA tag FG60067-NY
UBE2D3 cDNA ORF Clone, Ferret, C-Myc tag FG60067-CM
UBE2D3 cDNA ORF Clone, Ferret, N-Myc tag FG60067-NM

UBE2D3 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
UBE2D3 cDNA ORF Clone in Cloning Vector, Rabbit TG65104-G
UBE2D3 cDNA ORF Clone, Rabbit, untagged TG65104-UT
UBE2D3 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65104-ACG
UBE2D3 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65104-ANG
UBE2D3 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65104-ACR
UBE2D3 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65104-ANR
UBE2D3 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65104-CF
UBE2D3 cDNA ORF Clone, Rabbit, C-His tag TG65104-CH
UBE2D3 cDNA ORF Clone, Rabbit, N-His tag TG65104-NH
UBE2D3 cDNA ORF Clone, Rabbit, C-HA tag TG65104-CY
UBE2D3 cDNA ORF Clone, Rabbit, N-HA tag TG65104-NY
UBE2D3 cDNA ORF Clone, Rabbit, C-Myc tag TG65104-CM
UBE2D3 cDNA ORF Clone, Rabbit, N-Myc tag TG65104-NM

UBE2D3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBE2D3 cDNA ORF Clone in Cloning Vector, Rat RG80836-U
UBE2D3 cDNA ORF Clone, Rat, untagged RG80836-UT
UBE2D3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80836-ACGLN
UBE2D3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80836-ACG
UBE2D3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80836-ACR
UBE2D3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80836-CF
UBE2D3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80836-NF
UBE2D3 cDNA ORF Clone, Rat, C-His tag RG80836-CH
UBE2D3 cDNA ORF Clone, Rat, N-His tag RG80836-NH
UBE2D3 cDNA ORF Clone, Rat, C-HA tag RG80836-CY
UBE2D3 cDNA ORF Clone, Rat, N-HA tag RG80836-NY
UBE2D3 cDNA ORF Clone, Rat, C-Myc tag RG80836-CM
UBE2D3 cDNA ORF Clone, Rat, N-Myc tag RG80836-NM
UBE2D3 qPCR Primer Pairs, Rat RP300800

UBE2D3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBE2D3 cDNA ORF Clone in Cloning Vector, Mouse MG51789-G
UBE2D3 cDNA ORF Clone, Mouse, untagged MG51789-UT
UBE2D3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51789-ACGLN
UBE2D3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51789-ACG
UBE2D3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51789-ANG
UBE2D3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51789-ACR
UBE2D3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51789-ANR
UBE2D3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51789-CF
UBE2D3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51789-NF
UBE2D3 cDNA ORF Clone, Mouse, C-His tag MG51789-CH
UBE2D3 cDNA ORF Clone, Mouse, N-His tag MG51789-NH
UBE2D3 cDNA ORF Clone, Mouse, C-HA tag MG51789-CY
UBE2D3 cDNA ORF Clone, Mouse, N-HA tag MG51789-NY
UBE2D3 cDNA ORF Clone, Mouse, C-Myc tag MG51789-CM
UBE2D3 cDNA ORF Clone, Mouse, N-Myc tag MG51789-NM
UBE2D3 qPCR Primer Pairs, Mouse MP201662

UBE2D3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBE2D3 cDNA ORF Clone in Cloning Vector, Human HG16261-G
UBE2D3 cDNA ORF Clone, Human, untagged HG16261-UT
UBE2D3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16261-ACG
UBE2D3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16261-ACGLN
UBE2D3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16261-ACR
UBE2D3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16261-CF
UBE2D3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16261-NF
UBE2D3 cDNA ORF Clone, Human, C-His tag HG16261-CH
UBE2D3 cDNA ORF Clone, Human, N-His tag HG16261-NH
UBE2D3 cDNA ORF Clone, Human, C-HA tag HG16261-CY
UBE2D3 cDNA ORF Clone, Human, N-HA tag HG16261-NY
UBE2D3 cDNA ORF Clone, Human, C-Myc tag HG16261-CM
UBE2D3 cDNA ORF Clone, Human, N-Myc tag HG16261-NM
UBE2D3 qPCR Primer Pairs, Human HP105024
info info
添加购物车成功! 添加购物车失败!