POLR2C cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65083-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All POLR2C Reagents
CRO Services
Product recommended

All POLR2C Reagents
POLR2C cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
828 bp
Description
Full length Clone DNA of Rabbit DNA directed RNA polymerase II polypeptide C with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POLR2C Background Information
Full Name
polymerase (RNA) II (DNA directed) polypeptide C, 33kDa

POLR2C cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
POLR2C cDNA ORF Clone in Cloning Vector, Rabbit TG65083-G
POLR2C cDNA ORF Clone, Rabbit, untagged TG65083-UT
POLR2C cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65083-ACG
POLR2C cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65083-ANG
POLR2C cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65083-ACR
POLR2C cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65083-ANR
POLR2C cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65083-CF
POLR2C cDNA ORF Clone, Rabbit, C-His tag TG65083-CH
POLR2C cDNA ORF Clone, Rabbit, N-His tag TG65083-NH
POLR2C cDNA ORF Clone, Rabbit, C-HA tag TG65083-CY
POLR2C cDNA ORF Clone, Rabbit, N-HA tag TG65083-NY
POLR2C cDNA ORF Clone, Rabbit, C-Myc tag TG65083-CM
POLR2C cDNA ORF Clone, Rabbit, N-Myc tag TG65083-NM

POLR2C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
POLR2C cDNA ORF Clone in Cloning Vector, Rat RG87858-U
POLR2C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87858-ACGLN

POLR2C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POLR2C cDNA ORF Clone in Cloning Vector, Mouse MG53778-U
POLR2C cDNA ORF Clone, Mouse, untagged MG53778-UT
POLR2C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53778-ACG
POLR2C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53778-ACGLN
POLR2C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53778-ANG
POLR2C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53778-ACR
POLR2C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53778-ANR
POLR2C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53778-CF
POLR2C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53778-NF
POLR2C cDNA ORF Clone, Mouse, C-His tag MG53778-CH
POLR2C cDNA ORF Clone, Mouse, N-His tag MG53778-NH
POLR2C cDNA ORF Clone, Mouse, C-HA tag MG53778-CY
POLR2C cDNA ORF Clone, Mouse, N-HA tag MG53778-NY
POLR2C cDNA ORF Clone, Mouse, C-Myc tag MG53778-CM
POLR2C cDNA ORF Clone, Mouse, N-Myc tag MG53778-NM

POLR2C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POLR2C cDNA ORF Clone in Cloning Vector, Human HG16896-U
POLR2C cDNA ORF Clone, Human, untagged HG16896-UT
POLR2C cDNA ORF Clone, Human, C-GFPSpark® tag HG16896-ACG
POLR2C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16896-ACGLN
POLR2C cDNA ORF Clone, Human, N-GFPSpark® tag HG16896-ANG
POLR2C cDNA ORF Clone, Human, C-OFPSpark® tag HG16896-ACR
POLR2C cDNA ORF Clone, Human, N-OFPSpark® tag HG16896-ANR
POLR2C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16896-CF
POLR2C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16896-NF
POLR2C cDNA ORF Clone, Human, C-His tag HG16896-CH
POLR2C cDNA ORF Clone, Human, N-His tag HG16896-NH
POLR2C cDNA ORF Clone, Human, C-HA tag HG16896-CY
POLR2C cDNA ORF Clone, Human, N-HA tag HG16896-NY
POLR2C cDNA ORF Clone, Human, C-Myc tag HG16896-CM
POLR2C cDNA ORF Clone, Human, N-Myc tag HG16896-NM
info info
添加购物车成功! 添加购物车失败!