HN1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65093-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HN1 Reagents
CRO Services
Product recommended

All HN1 Reagents
HN1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Rabbit hematological and neurological expressed sequence 1-like with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HN1 Background Information
Full Name
hematological and neurological expressed 1

HN1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
HN1 cDNA ORF Clone in Cloning Vector, Rabbit TG65093-G
HN1 cDNA ORF Clone, Rabbit, untagged TG65093-UT
HN1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65093-ACG
HN1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65093-ANG
HN1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65093-ACR
HN1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65093-ANR
HN1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65093-CF
HN1 cDNA ORF Clone, Rabbit, C-His tag TG65093-CH
HN1 cDNA ORF Clone, Rabbit, N-His tag TG65093-NH
HN1 cDNA ORF Clone, Rabbit, C-HA tag TG65093-CY
HN1 cDNA ORF Clone, Rabbit, N-HA tag TG65093-NY
HN1 cDNA ORF Clone, Rabbit, C-Myc tag TG65093-CM
HN1 cDNA ORF Clone, Rabbit, N-Myc tag TG65093-NM

HN1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HN1 cDNA ORF Clone in Cloning Vector, Rat RG80685-U
HN1 cDNA ORF Clone, Rat, untagged RG80685-UT
HN1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80685-ACGLN
HN1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80685-ACG
HN1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80685-ANG
HN1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80685-ACR
HN1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80685-ANR
HN1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80685-CF
HN1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80685-NF
HN1 cDNA ORF Clone, Rat, C-His tag RG80685-CH
HN1 cDNA ORF Clone, Rat, N-His tag RG80685-NH
HN1 cDNA ORF Clone, Rat, C-HA tag RG80685-CY
HN1 cDNA ORF Clone, Rat, N-HA tag RG80685-NY
HN1 cDNA ORF Clone, Rat, C-Myc tag RG80685-CM
HN1 cDNA ORF Clone, Rat, N-Myc tag RG80685-NM
HN1 qPCR Primer Pairs, Rat RP300649

HN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HN1 cDNA ORF Clone in Cloning Vector, Mouse MG51359-U
HN1 cDNA ORF Clone, Mouse, untagged MG51359-UT
HN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51359-ACG
HN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51359-ACGLN
HN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51359-ANG
HN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51359-ACR
HN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51359-ANR
HN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51359-CF
HN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51359-NF
HN1 cDNA ORF Clone, Mouse, C-His tag MG51359-CH
HN1 cDNA ORF Clone, Mouse, N-His tag MG51359-NH
HN1 cDNA ORF Clone, Mouse, C-HA tag MG51359-CY
HN1 cDNA ORF Clone, Mouse, N-HA tag MG51359-NY
HN1 cDNA ORF Clone, Mouse, C-Myc tag MG51359-CM
HN1 cDNA ORF Clone, Mouse, N-Myc tag MG51359-NM
HN1 qPCR Primer Pairs, Mouse MP201236

HN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HN1 cDNA ORF Clone in Cloning Vector, Human HG14335-G
HN1 cDNA ORF Clone, Human, untagged HG14335-UT
HN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14335-ACGLN
HN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14335-ACG
HN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14335-ANG
HN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14335-ACR
HN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14335-ANR
HN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14335-CF
HN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14335-NF
HN1 cDNA ORF Clone, Human, C-His tag HG14335-CH
HN1 cDNA ORF Clone, Human, N-His tag HG14335-NH
HN1 cDNA ORF Clone, Human, C-HA tag HG14335-CY
HN1 cDNA ORF Clone, Human, N-HA tag HG14335-NY
HN1 cDNA ORF Clone, Human, C-Myc tag HG14335-CM
HN1 cDNA ORF Clone, Human, N-Myc tag HG14335-NM
HN1 qPCR Primer Pairs, Human HP102985
info info
添加购物车成功! 添加购物车失败!