HIBADH cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag

Cat: TG65019-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HIBADH Reagents
CRO Services
Product recommended

All HIBADH Reagents
HIBADH cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1011 bp
Description
Full length Clone DNA of Rabbit 3-hydroxyisobutyrate dehydrogenase-like with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIBADH Background Information
Full Name
3-hydroxyisobutyrate dehydrogenase

HIBADH cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
HIBADH cDNA ORF Clone in Cloning Vector, Rabbit TG65019-G
HIBADH cDNA ORF Clone, Rabbit, untagged TG65019-UT
HIBADH cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65019-ACG
HIBADH cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65019-ANG
HIBADH cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65019-ACR
HIBADH cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65019-ANR
HIBADH cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65019-NF
HIBADH cDNA ORF Clone, Rabbit, C-His tag TG65019-CH
HIBADH cDNA ORF Clone, Rabbit, N-His tag TG65019-NH
HIBADH cDNA ORF Clone, Rabbit, C-HA tag TG65019-CY
HIBADH cDNA ORF Clone, Rabbit, N-HA tag TG65019-NY
HIBADH cDNA ORF Clone, Rabbit, C-Myc tag TG65019-CM
HIBADH cDNA ORF Clone, Rabbit, N-Myc tag TG65019-NM

HIBADH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HIBADH cDNA ORF Clone in Cloning Vector, Mouse MG52599-U
HIBADH cDNA ORF Clone, Mouse, untagged MG52599-UT
HIBADH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52599-ACG
HIBADH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52599-ACGLN
HIBADH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52599-ANG
HIBADH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52599-ACR
HIBADH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52599-ANR
HIBADH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52599-CF
HIBADH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52599-NF
HIBADH cDNA ORF Clone, Mouse, C-His tag MG52599-CH
HIBADH cDNA ORF Clone, Mouse, N-His tag MG52599-NH
HIBADH cDNA ORF Clone, Mouse, C-HA tag MG52599-CY
HIBADH cDNA ORF Clone, Mouse, N-HA tag MG52599-NY
HIBADH cDNA ORF Clone, Mouse, C-Myc tag MG52599-CM
HIBADH cDNA ORF Clone, Mouse, N-Myc tag MG52599-NM
HIBADH qPCR Primer Pairs, Mouse MP202470

HIBADH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HIBADH cDNA ORF Clone in Cloning Vector, Human HG22607-U
HIBADH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22607-ACGLN
info info
添加购物车成功! 添加购物车失败!