IDH3B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65100-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IDH3B Reagents
CRO Services
Product recommended

All IDH3B Reagents
IDH3B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1158 bp
Description
Full length Clone DNA of Rabbit isocitrate dehydrogenase 3, beta subunit with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDH3B Background Information
Full Name
isocitrate dehydrogenase 3 (NAD+) beta

IDH3B cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
IDH3B cDNA ORF Clone in Cloning Vector, Rabbit TG65100-G
IDH3B cDNA ORF Clone, Rabbit, untagged TG65100-UT
IDH3B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65100-ACG
IDH3B cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65100-ANG
IDH3B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65100-ACR
IDH3B cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65100-ANR
IDH3B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65100-CF
IDH3B cDNA ORF Clone, Rabbit, C-His tag TG65100-CH
IDH3B cDNA ORF Clone, Rabbit, N-His tag TG65100-NH
IDH3B cDNA ORF Clone, Rabbit, C-HA tag TG65100-CY
IDH3B cDNA ORF Clone, Rabbit, N-HA tag TG65100-NY
IDH3B cDNA ORF Clone, Rabbit, C-Myc tag TG65100-CM
IDH3B cDNA ORF Clone, Rabbit, N-Myc tag TG65100-NM

IDH3B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IDH3B cDNA ORF Clone in Cloning Vector, Rat RG81270-U
IDH3B cDNA ORF Clone, Rat, untagged RG81270-UT
IDH3B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81270-ACG
IDH3B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81270-ACGLN
IDH3B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81270-ANG
IDH3B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81270-ACR
IDH3B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81270-ANR
IDH3B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81270-CF
IDH3B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81270-NF
IDH3B cDNA ORF Clone, Rat, C-His tag RG81270-CH
IDH3B cDNA ORF Clone, Rat, N-His tag RG81270-NH
IDH3B cDNA ORF Clone, Rat, C-HA tag RG81270-CY
IDH3B cDNA ORF Clone, Rat, N-HA tag RG81270-NY
IDH3B cDNA ORF Clone, Rat, C-Myc tag RG81270-CM
IDH3B cDNA ORF Clone, Rat, N-Myc tag RG81270-NM
IDH3B qPCR Primer Pairs, Rat RP301226

IDH3B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IDH3B cDNA ORF Clone in Cloning Vector, Mouse MG52264-G
IDH3B cDNA ORF Clone, Mouse, untagged MG52264-UT
IDH3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52264-ACGLN
IDH3B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52264-ACG
IDH3B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52264-ANG
IDH3B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52264-ACR
IDH3B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52264-ANR
IDH3B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52264-CF
IDH3B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52264-NF
IDH3B cDNA ORF Clone, Mouse, C-His tag MG52264-CH
IDH3B cDNA ORF Clone, Mouse, N-His tag MG52264-NH
IDH3B cDNA ORF Clone, Mouse, C-HA tag MG52264-CY
IDH3B cDNA ORF Clone, Mouse, N-HA tag MG52264-NY
IDH3B cDNA ORF Clone, Mouse, C-Myc tag MG52264-CM
IDH3B cDNA ORF Clone, Mouse, N-Myc tag MG52264-NM
IDH3B qPCR Primer Pairs, Mouse MP202137

IDH3B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IDH3B cDNA ORF Clone, Human, untagged HG20356-UT
info info
添加购物车成功! 添加购物车失败!