MPHOSPH6 cDNA ORF Clone, Rabbit, C-Myc tag

Cat: TG65038-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MPHOSPH6 Reagents
CRO Services
Product recommended

All MPHOSPH6 Reagents
MPHOSPH6 cDNA ORF Clone, Rabbit, C-Myc tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Rabbit M-phase phosphoprotein 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPHOSPH6 Background Information
Full Name
M-phase phosphoprotein 6

MPHOSPH6 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
MPHOSPH6 cDNA ORF Clone in Cloning Vector, Rabbit TG65038-G
MPHOSPH6 cDNA ORF Clone, Rabbit, untagged TG65038-UT
MPHOSPH6 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65038-ACG
MPHOSPH6 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65038-ANG
MPHOSPH6 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65038-ACR
MPHOSPH6 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65038-ANR
MPHOSPH6 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65038-CF
MPHOSPH6 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65038-NF
MPHOSPH6 cDNA ORF Clone, Rabbit, C-His tag TG65038-CH
MPHOSPH6 cDNA ORF Clone, Rabbit, N-His tag TG65038-NH
MPHOSPH6 cDNA ORF Clone, Rabbit, C-HA tag TG65038-CY
MPHOSPH6 cDNA ORF Clone, Rabbit, N-HA tag TG65038-NY
MPHOSPH6 cDNA ORF Clone, Rabbit, N-Myc tag TG65038-NM

MPHOSPH6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MPHOSPH6 cDNA ORF Clone in Cloning Vector, Rat RG8A4534-U
MPHOSPH6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4534-ACGLN

MPHOSPH6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPHOSPH6 cDNA ORF Clone in Cloning Vector, Mouse MG52816-G
MPHOSPH6 cDNA ORF Clone, Mouse, untagged MG52816-UT
MPHOSPH6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52816-ACGLN
MPHOSPH6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52816-ACG
MPHOSPH6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52816-ANG
MPHOSPH6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52816-ACR
MPHOSPH6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52816-ANR
MPHOSPH6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52816-CF
MPHOSPH6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52816-NF
MPHOSPH6 cDNA ORF Clone, Mouse, C-His tag MG52816-CH
MPHOSPH6 cDNA ORF Clone, Mouse, N-His tag MG52816-NH
MPHOSPH6 cDNA ORF Clone, Mouse, C-HA tag MG52816-CY
MPHOSPH6 cDNA ORF Clone, Mouse, N-HA tag MG52816-NY
MPHOSPH6 cDNA ORF Clone, Mouse, C-Myc tag MG52816-CM
MPHOSPH6 cDNA ORF Clone, Mouse, N-Myc tag MG52816-NM

MPHOSPH6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPHOSPH6 cDNA ORF Clone in Cloning Vector, Human HG14520-G
MPHOSPH6 cDNA ORF Clone, Human, untagged HG14520-UT
MPHOSPH6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14520-ACG
MPHOSPH6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14520-ACGLN
MPHOSPH6 cDNA ORF Clone, Human, N-GFPSpark® tag HG14520-ANG
MPHOSPH6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14520-ACR
MPHOSPH6 cDNA ORF Clone, Human, N-OFPSpark® tag HG14520-ANR
MPHOSPH6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14520-CF
MPHOSPH6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14520-NF
MPHOSPH6 cDNA ORF Clone, Human, C-His tag HG14520-CH
MPHOSPH6 cDNA ORF Clone, Human, N-His tag HG14520-NH
MPHOSPH6 cDNA ORF Clone, Human, C-HA tag HG14520-CY
MPHOSPH6 cDNA ORF Clone, Human, N-HA tag HG14520-NY
MPHOSPH6 cDNA ORF Clone, Human, C-Myc tag HG14520-CM
MPHOSPH6 cDNA ORF Clone, Human, N-Myc tag HG14520-NM
MPHOSPH6 qPCR Primer Pairs, Human HP103167
info info
添加购物车成功! 添加购物车失败!