HNRNPA1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65063-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HNRNPA1 Reagents
CRO Services
Product recommended

All HNRNPA1 Reagents
HNRNPA1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1116 bp
Description
Full length Clone DNA of Rabbit heterogeneous nuclear ribonucleoprotein A1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPA1 Background Information
Full Name
heterogeneous nuclear ribonucleoprotein A1

HNRNPA1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
HNRNPA1 cDNA ORF Clone in Cloning Vector, Rabbit TG65063-G
HNRNPA1 cDNA ORF Clone, Rabbit, untagged TG65063-UT
HNRNPA1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65063-ACG
HNRNPA1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65063-ANG
HNRNPA1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65063-ACR
HNRNPA1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65063-ANR
HNRNPA1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65063-CF
HNRNPA1 cDNA ORF Clone, Rabbit, C-His tag TG65063-CH
HNRNPA1 cDNA ORF Clone, Rabbit, N-His tag TG65063-NH
HNRNPA1 cDNA ORF Clone, Rabbit, C-HA tag TG65063-CY
HNRNPA1 cDNA ORF Clone, Rabbit, N-HA tag TG65063-NY
HNRNPA1 cDNA ORF Clone, Rabbit, C-Myc tag TG65063-CM
HNRNPA1 cDNA ORF Clone, Rabbit, N-Myc tag TG65063-NM

HNRNPA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HNRNPA1 cDNA ORF Clone in Cloning Vector, Rat RG81555-G

HNRNPA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HNRNPA1 cDNA ORF Clone in Cloning Vector, Mouse MG58766-U
HNRNPA1 cDNA ORF Clone, Mouse, untagged MG58766-UT
HNRNPA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58766-ACGLN
HNRNPA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58766-ACG
HNRNPA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58766-ANG
HNRNPA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58766-ACR
HNRNPA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58766-ANR
HNRNPA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58766-CF
HNRNPA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58766-NF
HNRNPA1 cDNA ORF Clone, Mouse, C-His tag MG58766-CH
HNRNPA1 cDNA ORF Clone, Mouse, N-His tag MG58766-NH
HNRNPA1 cDNA ORF Clone, Mouse, C-HA tag MG58766-CY
HNRNPA1 cDNA ORF Clone, Mouse, N-HA tag MG58766-NY
HNRNPA1 cDNA ORF Clone, Mouse, C-Myc tag MG58766-CM
HNRNPA1 cDNA ORF Clone, Mouse, N-Myc tag MG58766-NM

HNRNPA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPA1 cDNA ORF Clone in Cloning Vector, Human HG16537-G
HNRNPA1 cDNA ORF Clone, Human, untagged HG16537-UT
HNRNPA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16537-ACGLN
HNRNPA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16537-ACG
HNRNPA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16537-ANG
HNRNPA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16537-ACR
HNRNPA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16537-ANR
HNRNPA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16537-CF
HNRNPA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16537-NF
HNRNPA1 cDNA ORF Clone, Human, C-His tag HG16537-CH
HNRNPA1 cDNA ORF Clone, Human, N-His tag HG16537-NH
HNRNPA1 cDNA ORF Clone, Human, C-HA tag HG16537-CY
HNRNPA1 cDNA ORF Clone, Human, N-HA tag HG16537-NY
HNRNPA1 cDNA ORF Clone, Human, C-Myc tag HG16537-CM
HNRNPA1 cDNA ORF Clone, Human, N-Myc tag HG16537-NM
info info
添加购物车成功! 添加购物车失败!