TUBA1B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag

Cat: TG65027-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TUBA1B Reagents
CRO Services
Product recommended

All TUBA1B Reagents
TUBA1B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1356 bp
Description
Full length Clone DNA of Rabbit alpha tubulin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBA1B Background Information
Full Name
tubulin, alpha 1b

TUBA1B cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TUBA1B cDNA ORF Clone in Cloning Vector, Cynomolgus CG90792-G
TUBA1B cDNA ORF Clone, Cynomolgus, untagged CG90792-UT
TUBA1B Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90792-ACGLN
TUBA1B cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90792-ACG
TUBA1B cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90792-ANG
TUBA1B cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90792-ACR
TUBA1B cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90792-ANR
TUBA1B cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90792-CF
TUBA1B cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90792-NF
TUBA1B cDNA ORF Clone, Cynomolgus, C-His tag CG90792-CH
TUBA1B cDNA ORF Clone, Cynomolgus, N-His tag CG90792-NH
TUBA1B cDNA ORF Clone, Cynomolgus, C-HA tag CG90792-CY
TUBA1B cDNA ORF Clone, Cynomolgus, N-HA tag CG90792-NY
TUBA1B cDNA ORF Clone, Cynomolgus, C-Myc tag CG90792-CM
TUBA1B cDNA ORF Clone, Cynomolgus, N-Myc tag CG90792-NM

TUBA1B cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
TUBA1B cDNA ORF Clone in Cloning Vector, Rabbit TG65027-G
TUBA1B cDNA ORF Clone, Rabbit, untagged TG65027-UT
TUBA1B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65027-ACG
TUBA1B cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65027-ANG
TUBA1B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65027-ACR
TUBA1B cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65027-ANR
TUBA1B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65027-NF
TUBA1B cDNA ORF Clone, Rabbit, C-His tag TG65027-CH
TUBA1B cDNA ORF Clone, Rabbit, N-His tag TG65027-NH
TUBA1B cDNA ORF Clone, Rabbit, C-HA tag TG65027-CY
TUBA1B cDNA ORF Clone, Rabbit, N-HA tag TG65027-NY
TUBA1B cDNA ORF Clone, Rabbit, C-Myc tag TG65027-CM
TUBA1B cDNA ORF Clone, Rabbit, N-Myc tag TG65027-NM

TUBA1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TUBA1B cDNA ORF Clone in Cloning Vector, Rat RG81153-U
TUBA1B cDNA ORF Clone, Rat, untagged RG81153-UT
TUBA1B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81153-ACG
TUBA1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81153-ACGLN
TUBA1B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81153-ANG
TUBA1B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81153-ACR
TUBA1B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81153-ANR
TUBA1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81153-CF
TUBA1B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81153-NF
TUBA1B cDNA ORF Clone, Rat, C-His tag RG81153-CH
TUBA1B cDNA ORF Clone, Rat, N-His tag RG81153-NH
TUBA1B cDNA ORF Clone, Rat, C-HA tag RG81153-CY
TUBA1B cDNA ORF Clone, Rat, N-HA tag RG81153-NY
TUBA1B cDNA ORF Clone, Rat, C-Myc tag RG81153-CM
TUBA1B cDNA ORF Clone, Rat, N-Myc tag RG81153-NM
TUBA1B qPCR Primer Pairs, Rat RP301109

TUBA1B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBA1B cDNA ORF Clone in Cloning Vector, Mouse MG51606-U
TUBA1B cDNA ORF Clone, Mouse, untagged MG51606-UT
TUBA1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51606-ACG
TUBA1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51606-ACGLN
TUBA1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51606-ANG
TUBA1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51606-ACR
TUBA1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51606-ANR
TUBA1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51606-CF
TUBA1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51606-NF
TUBA1B cDNA ORF Clone, Mouse, C-His tag MG51606-CH
TUBA1B cDNA ORF Clone, Mouse, N-His tag MG51606-NH
TUBA1B cDNA ORF Clone, Mouse, C-HA tag MG51606-CY
TUBA1B cDNA ORF Clone, Mouse, N-HA tag MG51606-NY
TUBA1B cDNA ORF Clone, Mouse, C-Myc tag MG51606-CM
TUBA1B cDNA ORF Clone, Mouse, N-Myc tag MG51606-NM
TUBA1B qPCR Primer Pairs, Mouse MP201273

TUBA1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBA1B cDNA ORF Clone in Cloning Vector, Human HG14070-G
TUBA1B cDNA ORF Clone, Human, untagged HG14070-UT
TUBA1B cDNA ORF Clone, Human, C-GFPSpark® tag HG14070-ACG
TUBA1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14070-ACGLN
TUBA1B cDNA ORF Clone, Human, N-GFPSpark® tag HG14070-ANG
TUBA1B cDNA ORF Clone, Human, C-OFPSpark® tag HG14070-ACR
TUBA1B cDNA ORF Clone, Human, N-OFPSpark® tag HG14070-ANR
TUBA1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14070-CF
TUBA1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14070-NF
TUBA1B cDNA ORF Clone, Human, C-His tag HG14070-CH
TUBA1B cDNA ORF Clone, Human, N-His tag HG14070-NH
TUBA1B cDNA ORF Clone, Human, C-HA tag HG14070-CY
TUBA1B cDNA ORF Clone, Human, N-HA tag HG14070-NY
TUBA1B cDNA ORF Clone, Human, C-Myc tag HG14070-CM
TUBA1B cDNA ORF Clone, Human, N-Myc tag HG14070-NM
TUBA1B qPCR Primer Pairs, Human HP102725
info info
添加购物车成功! 添加购物车失败!