PAPSS1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65140-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PAPSS1 Reagents
CRO Services
Product recommended

All PAPSS1 Reagents
PAPSS1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1875 bp
Description
Full length Clone DNA of Rabbit PAPS synthase 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAPSS1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PAPSS1 cDNA ORF Clone in Cloning Vector, Rabbit TG65140-G
PAPSS1 cDNA ORF Clone, Rabbit, untagged TG65140-UT
PAPSS1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65140-ACG
PAPSS1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65140-ANG
PAPSS1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65140-ACR
PAPSS1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65140-ANR
PAPSS1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65140-CF
PAPSS1 cDNA ORF Clone, Rabbit, C-His tag TG65140-CH
PAPSS1 cDNA ORF Clone, Rabbit, N-His tag TG65140-NH
PAPSS1 cDNA ORF Clone, Rabbit, C-HA tag TG65140-CY
PAPSS1 cDNA ORF Clone, Rabbit, N-HA tag TG65140-NY
PAPSS1 cDNA ORF Clone, Rabbit, C-Myc tag TG65140-CM
PAPSS1 cDNA ORF Clone, Rabbit, N-Myc tag TG65140-NM

PAPSS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PAPSS1 cDNA ORF Clone in Cloning Vector, Rat RG8A1683-U
PAPSS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1683-ACGLN

PAPSS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PAPSS1 cDNA ORF Clone in Cloning Vector, Mouse MG5A1064-U
PAPSS1 cDNA ORF Clone, Mouse, untagged MG5A1064-UT
PAPSS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1064-ACG
PAPSS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1064-ACGLN
PAPSS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1064-ANG
PAPSS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1064-ACR
PAPSS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1064-ANR
PAPSS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1064-CF
PAPSS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1064-NF
PAPSS1 cDNA ORF Clone, Mouse, C-His tag MG5A1064-CH
PAPSS1 cDNA ORF Clone, Mouse, N-His tag MG5A1064-NH
PAPSS1 cDNA ORF Clone, Mouse, C-HA tag MG5A1064-CY
PAPSS1 cDNA ORF Clone, Mouse, N-HA tag MG5A1064-NY
PAPSS1 cDNA ORF Clone, Mouse, C-Myc tag MG5A1064-CM
PAPSS1 cDNA ORF Clone, Mouse, N-Myc tag MG5A1064-NM

PAPSS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PAPSS1 cDNA ORF Clone in Cloning Vector, Human HG19299-U
PAPSS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19299-ACGLN
info info
添加购物车成功! 添加购物车失败!