Quick Order

Rabbit FTL ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rabbit FTL cDNA Clone Product Information
NCBI RefSeq:NM_001101688.1
RefSeq ORF Size:528bp
cDNA Description:Full length Clone DNA of Rabbit ferritin, light polypeptide with C terminal Flag tag.
Gene Synonym:FTL2
Species:Rabbit
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

References
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"