CKMT1A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag

Cat: TG65032-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CKMT1A Reagents
CRO Services
Product recommended

All CKMT1A Reagents
CKMT1A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Rabbit creatine kinase, mitochondrial 1A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CKMT1A Background Information

CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. CKMT1A gene is one of two genes which encode the ubiquitous mitochondrial creatine kinase (CKMT1). CKMT1 is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK (CKMT2) and ubiquitous MtCK, encoded by separate genes. CKMT1 occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric CKMT1.

Full Name
creatine kinase, mitochondrial 1A
References
  • Haas RC, et al. (1989) Isolation and characterization of the gene and cDNA encoding human mitochondrial creatine kinase. J Biol Chem. 264(5):2890-7.
  • Stachowiak O, et al. (1998) Oligomeric state and membrane binding behaviour of creatine kinase isoenzymes: implications for cellular function and mitochondrial structure. Mol Cell Biochem. 184(1-2):141-51.
  • Lipskaya TY. (2001) Mitochondrial creatine kinase: properties and function. Biochemistry Mosc. 66(10):1098-111.
  • CKMT1A cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    CKMT1A cDNA ORF Clone in Cloning Vector, Rabbit TG65032-G
    CKMT1A cDNA ORF Clone, Rabbit, untagged TG65032-UT
    CKMT1A cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65032-ACG
    CKMT1A Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65032-ACGLN
    CKMT1A cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65032-ANG
    CKMT1A cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65032-ACR
    CKMT1A cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65032-ANR
    CKMT1A cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65032-NF
    CKMT1A cDNA ORF Clone, Rabbit, C-His tag TG65032-CH
    CKMT1A cDNA ORF Clone, Rabbit, N-His tag TG65032-NH
    CKMT1A cDNA ORF Clone, Rabbit, C-HA tag TG65032-CY
    CKMT1A cDNA ORF Clone, Rabbit, N-HA tag TG65032-NY
    CKMT1A cDNA ORF Clone, Rabbit, C-Myc tag TG65032-CM
    CKMT1A cDNA ORF Clone, Rabbit, N-Myc tag TG65032-NM

    CKMT1A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CKMT1A cDNA ORF Clone in Cloning Vector, Human HG13924-G
    CKMT1A cDNA ORF Clone, Human, untagged HG13924-UT
    CKMT1A cDNA ORF Clone, Human, C-GFPSpark® tag HG13924-ACG
    CKMT1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13924-ACGLN
    CKMT1A cDNA ORF Clone, Human, N-GFPSpark® tag HG13924-ANG
    CKMT1A cDNA ORF Clone, Human, C-OFPSpark® tag HG13924-ACR
    CKMT1A cDNA ORF Clone, Human, N-OFPSpark® tag HG13924-ANR
    CKMT1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13924-CF
    CKMT1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13924-NF
    CKMT1A cDNA ORF Clone, Human, C-His tag HG13924-CH
    CKMT1A cDNA ORF Clone, Human, N-His tag HG13924-NH
    CKMT1A cDNA ORF Clone, Human, C-HA tag HG13924-CY
    CKMT1A cDNA ORF Clone, Human, N-HA tag HG13924-NY
    CKMT1A cDNA ORF Clone, Human, C-Myc tag HG13924-CM
    CKMT1A cDNA ORF Clone, Human, N-Myc tag HG13924-NM
    CKMT1A qPCR Primer Pairs, Human HP102587
    info info
    添加购物车成功! 添加购物车失败!