Quick Order

Text Size:AAA

Rabbit CKMT1A Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rabbit CKMT1A cDNA Clone Product Information
NCBI RefSeq:NM_001171313.1
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Rabbit creatine kinase, mitochondrial 1A with C terminal Myc tag.
Gene Synonym:CKMT1A
Species:Rabbit
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. CKMT1A gene is one of two genes which encode the ubiquitous mitochondrial creatine kinase (CKMT1). CKMT1 is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK (CKMT2) and ubiquitous MtCK, encoded by separate genes. CKMT1 occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric CKMT1.

References
  • Haas RC, et al. (1989) Isolation and characterization of the gene and cDNA encoding human mitochondrial creatine kinase. J Biol Chem. 264(5):2890-7.
  • Stachowiak O, et al. (1998) Oligomeric state and membrane binding behaviour of creatine kinase isoenzymes: implications for cellular function and mitochondrial structure. Mol Cell Biochem. 184(1-2):141-51.
  • Lipskaya TY. (2001) Mitochondrial creatine kinase: properties and function. Biochemistry Mosc. 66(10):1098-111.
  • Size / Price
    Catalog: TG65032-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"