CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag

Cat: TG65035-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCT2/TCP1 beta Reagents
CRO Services
Product recommended

All CCT2/TCP1 beta Reagents
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1608 bp
Description
Full length Clone DNA of Rabbit chaperonin containing TCP1, subunit 2 (beta) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCT2/TCP1 beta Background Information
Full Name
chaperonin containing TCP1, subunit 2 (beta)

CCT2/TCP1 beta cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCT2/TCP1 beta cDNA ORF Clone in Cloning Vector, Rhesus CG90496-G
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, untagged CG90496-UT
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90496-ACG
CCT2/TCP1 beta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90496-ACGLN
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90496-ANG
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90496-ACR
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90496-ANR
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90496-CF
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90496-NF
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, C-His tag CG90496-CH
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, N-His tag CG90496-NH
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, C-HA tag CG90496-CY
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, N-HA tag CG90496-NY
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, C-Myc tag CG90496-CM
CCT2/TCP1 beta cDNA ORF Clone, Rhesus, N-Myc tag CG90496-NM

CCT2/TCP1 beta cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
CCT2/TCP1 beta cDNA ORF Clone in Cloning Vector, Rabbit TG65035-G
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, untagged TG65035-UT
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65035-ACG
CCT2/TCP1 beta Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65035-ACGLN
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65035-ANG
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65035-ACR
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65035-ANR
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65035-NF
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-His tag TG65035-CH
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, N-His tag TG65035-NH
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-HA tag TG65035-CY
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, N-HA tag TG65035-NY
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, C-Myc tag TG65035-CM
CCT2/TCP1 beta cDNA ORF Clone, Rabbit, N-Myc tag TG65035-NM

CCT2/TCP1 beta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCT2/TCP1 beta cDNA ORF Clone in Cloning Vector, Rat RG86884-U
CCT2/TCP1 beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86884-ACGLN

CCT2/TCP1 beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCT2/TCP1 beta cDNA ORF Clone in Cloning Vector, Mouse MG52110-G
CCT2/TCP1 beta cDNA ORF Clone, Mouse, untagged MG52110-UT
CCT2/TCP1 beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52110-ACG
CCT2/TCP1 beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52110-ACGLN
CCT2/TCP1 beta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52110-ANG
CCT2/TCP1 beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52110-ACR
CCT2/TCP1 beta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52110-ANR
CCT2/TCP1 beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52110-CF
CCT2/TCP1 beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52110-NF
CCT2/TCP1 beta cDNA ORF Clone, Mouse, C-His tag MG52110-CH
CCT2/TCP1 beta cDNA ORF Clone, Mouse, N-His tag MG52110-NH
CCT2/TCP1 beta cDNA ORF Clone, Mouse, C-HA tag MG52110-CY
CCT2/TCP1 beta cDNA ORF Clone, Mouse, N-HA tag MG52110-NY
CCT2/TCP1 beta cDNA ORF Clone, Mouse, C-Myc tag MG52110-CM
CCT2/TCP1 beta cDNA ORF Clone, Mouse, N-Myc tag MG52110-NM
CCT2/TCP1 beta qPCR Primer Pairs, Mouse MP201983

CCT2/TCP1 beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCT2/TCP1 beta cDNA ORF Clone in Cloning Vector, Human HG16584-G
CCT2/TCP1 beta cDNA ORF Clone, Human, untagged HG16584-UT
CCT2/TCP1 beta cDNA ORF Clone, Human, C-GFPSpark® tag HG16584-ACG
CCT2/TCP1 beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16584-ACGLN
CCT2/TCP1 beta cDNA ORF Clone, Human, N-GFPSpark® tag HG16584-ANG
CCT2/TCP1 beta cDNA ORF Clone, Human, C-OFPSpark® tag HG16584-ACR
CCT2/TCP1 beta cDNA ORF Clone, Human, N-OFPSpark® tag HG16584-ANR
CCT2/TCP1 beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16584-CF
CCT2/TCP1 beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16584-NF
CCT2/TCP1 beta cDNA ORF Clone, Human, C-His tag HG16584-CH
CCT2/TCP1 beta cDNA ORF Clone, Human, N-His tag HG16584-NH
CCT2/TCP1 beta cDNA ORF Clone, Human, C-HA tag HG16584-CY
CCT2/TCP1 beta cDNA ORF Clone, Human, N-HA tag HG16584-NY
CCT2/TCP1 beta cDNA ORF Clone, Human, C-Myc tag HG16584-CM
CCT2/TCP1 beta cDNA ORF Clone, Human, N-Myc tag HG16584-NM
info info
添加购物车成功! 添加购物车失败!