Calnexin cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag

Cat: TG65135-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Calnexin Reagents
CRO Services
Product recommended

All Calnexin Reagents
Calnexin cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag General Information
Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1782 bp
Description
Full length Clone DNA of Rabbit calnexin with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Calnexin Background Information

Calnexin is a calcium-binding protein that belongs to the calreticulin family. It interacts with newly synthesized glycoproteins in the endoplasmic reticulum. Calnexin seems to play a major role in the quality control apparatus of the ER by the retention of incorrectly folded proteins. It may act in assisting protein assembly and/or in the retention within the ER of unassembled protein subunits. Associated with partial T-cell antigen receptor complexes that escape the ER of immature thymocytes, it may function as a signaling complex regulating thymocyte maturation. Additionally it may play a role in receptor-mediated endocytosis at the synapse.

Full Name
calnexin
References
  • Rajagopalan S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Lenter M, et al. (1994) The integrin chains beta 1 and alpha 6 associate with the chaperone Calnexin(CANX) prior to integrin assembly. J Biol Chem. 269(16):12263-8.
  • Pind S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Calnexin cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    Calnexin cDNA ORF Clone in Cloning Vector, Rabbit TG65135-G
    Calnexin cDNA ORF Clone, Rabbit, untagged TG65135-UT
    Calnexin Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65135-ACGLN
    Calnexin cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65135-ACG
    Calnexin cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65135-ACR
    Calnexin cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65135-CF
    Calnexin cDNA ORF Clone, Rabbit, C-His tag TG65135-CH
    Calnexin cDNA ORF Clone, Rabbit, N-His tag TG65135-NH
    Calnexin cDNA ORF Clone, Rabbit, C-HA tag TG65135-CY
    Calnexin cDNA ORF Clone, Rabbit, N-HA tag TG65135-NY
    Calnexin cDNA ORF Clone, Rabbit, C-Myc tag TG65135-CM
    Calnexin cDNA ORF Clone, Rabbit, N-Myc tag TG65135-NM

    Calnexin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Calnexin cDNA ORF Clone in Cloning Vector, Rat RG82661-U
    Calnexin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82661-ACGLN

    Calnexin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Calnexin cDNA ORF Clone in Cloning Vector, Mouse MG53126-G
    Calnexin cDNA ORF Clone, Mouse, untagged MG53126-UT
    Calnexin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53126-ACGLN
    Calnexin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53126-ACG
    Calnexin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53126-ACR
    Calnexin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53126-CF
    Calnexin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53126-NF
    Calnexin cDNA ORF Clone, Mouse, C-His tag MG53126-CH
    Calnexin cDNA ORF Clone, Mouse, N-His tag MG53126-NH
    Calnexin cDNA ORF Clone, Mouse, C-HA tag MG53126-CY
    Calnexin cDNA ORF Clone, Mouse, N-HA tag MG53126-NY
    Calnexin cDNA ORF Clone, Mouse, C-Myc tag MG53126-CM
    Calnexin cDNA ORF Clone, Mouse, N-Myc tag MG53126-NM

    Calnexin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Calnexin cDNA ORF Clone in Cloning Vector, Human HG13929-U
    Calnexin cDNA ORF Clone, Human, untagged HG13929-UT
    Calnexin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13929-ACGLN
    Calnexin cDNA ORF Clone, Human, C-GFPSpark® tag HG13929-ACG
    Calnexin cDNA ORF Clone, Human, C-OFPSpark® tag HG13929-ACR
    Calnexin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13929-CF
    Calnexin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13929-NF
    Calnexin cDNA ORF Clone, Human, C-His tag HG13929-CH
    Calnexin cDNA ORF Clone, Human, N-His tag HG13929-NH
    Calnexin cDNA ORF Clone, Human, C-HA tag HG13929-CY
    Calnexin cDNA ORF Clone, Human, N-HA tag HG13929-NY
    Calnexin cDNA ORF Clone, Human, C-Myc tag HG13929-CM
    Calnexin cDNA ORF Clone, Human, N-Myc tag HG13929-NM
    info info
    添加购物车成功! 添加购物车失败!