Text Size:AAA

Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-FcDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:1725
cDNA Description:ORF Clone of Human RSV (subtype A, strain Long) Fusion glycoprotein / RSV-F DNA.
Gene Synonym:F, HRSVgp08
Species:RSV
Vector:pCMV/hygro-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P12568.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro-FLAG Physical Map
Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40039-CF315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40039-CH315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40039-CM315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40039-CY315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40039-G195
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40039-NF315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40039-NH315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40039-NM315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40039-NY315
Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40039-UT315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"