Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPGRcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10525-ACG$345
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10525-ACR$345
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10525-ANG$345
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10525-ANR$345
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10525-CF$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10525-CH$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10525-CM$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10525-CY$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone)HG10525-M$115
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10525-M-F$345
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10525-NF$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10525-NH$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10525-NM$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10525-NY$315
Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10525-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Images
  • Human RPGR transcript variant A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"