Quick Order

Human ROR1/NTRKR1 Gene ORF cDNA clone expression plasmid, C-HA tag

  • Human ROR1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
DatasheetReviewsRelated ProductsProtocols
Human ROR1 cDNA Clone Product Information
NCBI RefSeq:NM_005012.3
RefSeq ORF Size:2814bp
cDNA Description:Full length Clone DNA of Homo sapiens receptor tyrosine kinase-like orphan receptor 1 with HA tag.
Gene Synonym:NTRKR1, dJ537F10.1
Restriction Site:KpnI + XhoI (5.5kb + 2.84kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 180 C/T, 1170 G/T, 1353 A/G not causing the amino acid variation.
( We provide with ROR1 qPCR primers for gene expression analysis, HP102625 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ROR1 Gene Plasmid Map
Human ROR1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.