After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human ROBO2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

ROBO2 belongs to the ROBO family. Members of the ROBO family are a group of highly conserved transmembrane glycoproteins that make up a small subgroup of the immunoglobulin (Ig) superfamily. They are best known for their roles as receptors for the Slit family of repellent axon guidance cues. In structure, ROBOs are characterized by five C2-type Ig-like repeats, three fibronectin type III domains, a transmembrane region, and an intracellular domain with three (ROBO3) or four (ROBO1, 2) CC (conserved cytoplasmic) motifs. ROBO2 is a receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development. ROBO2 also abrogates SLIT-ROBO signaling in vitro.

  • Brose K, et al. (1999) Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96(6):795-806.
  • Brose K, et al. (1999) Slit2-Mediated chemorepulsion and collapse of developing forebrain axons. Neuron. 22(3):463-73.
  • Nagase T, et al. (2001) Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 7(4):273-81.
  • Contact Us
        Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.