Quick Order

Mouse RIPK3 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse RIPK3 cDNA Clone Product Information
NCBI RefSeq:NM_019955.2
RefSeq ORF Size:1461bp
cDNA Description:Full length Clone DNA of Mus musculus receptor-interacting serine-threonine kinase 3.
Gene Synonym:Rip3, AW107945, 2610528K09Rik
Species:Mouse
Vector:pCMV/hygro
Plasmid:pCMV-mRIPK3
Restriction Site:KpnI + XhoI (5.5kb + 1.46kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse RIPK3 Gene Plasmid Map
Mouse RIPK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: MG51069-G-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"