Text Size:AAA

Mouse RIPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RIPK1cDNA Clone Product Information
Gene Bank Ref.ID:NM_009068.3
cDNA Size:1971
cDNA Description:ORF Clone of Mus musculus receptor (TNFRSF)-interacting serine-threonine kinase 1 DNA.
Gene Synonym:RIP, Rinp, Rip1, D330015H01Rik, Ripk1
Species:Mouse
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1418 C/T resulting in the amino acid Thr substitution by Ile.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"