RIPK1/RIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11268-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RIPK1/RIP1 Reagents
CRO Services

All RIPK1/RIP1 Reagents
RIPK1/RIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2016 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for three point mutations: 84 T/C, 381 C/T, 910 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human receptor (TNFRSF)-interacting serine-threonine kinase 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 2.05kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RIPK1/RIP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RIPK1/RIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human RIPK1/RIP1 Gene Expression validated Image 2454
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human RIPK1/RIP1 Gene Plasmid Map 7415
RIPK1/RIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
RIP cDNA ORF Clone, Human;RIP1 cDNA ORF Clone, Human
RIPK1/RIP1 Background Information
Full Name
receptor (TNFRSF)-interacting serine-threonine kinase 1

RIPK1/RIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RIPK1/RIP1 cDNA ORF Clone in Cloning Vector, Mouse MG51051-G
RIPK1/RIP1 cDNA ORF Clone, Mouse, untagged MG51051-UT
RIPK1/RIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51051-ACGLN
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51051-ACG
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51051-ANG
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51051-ACR
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51051-ANR
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51051-CF
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51051-NF
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-His tag MG51051-CH
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-His tag MG51051-NH
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-HA tag MG51051-CY
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-HA tag MG51051-NY
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-Myc tag MG51051-CM
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-Myc tag MG51051-NM
RIPK1/RIP1 qPCR Primer Pairs, Mouse MP201009

RIPK1/RIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RIPK1/RIP1 cDNA ORF Clone in Cloning Vector, Human HG11268-M
RIPK1/RIP1 cDNA ORF Clone, Human, untagged HG11268-UT
RIPK1/RIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11268-ACGLN
RIPK1/RIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11268-ACG
RIPK1/RIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11268-ANG
RIPK1/RIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11268-ACR
RIPK1/RIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11268-ANR
RIPK1/RIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11268-CF
RIPK1/RIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11268-NF
RIPK1/RIP1 cDNA ORF Clone, Human, C-His tag HG11268-CH
RIPK1/RIP1 cDNA ORF Clone, Human, N-His tag HG11268-NH
RIPK1/RIP1 cDNA ORF Clone, Human, C-HA tag HG11268-CY
RIPK1/RIP1 cDNA ORF Clone, Human, N-HA tag HG11268-NY
RIPK1/RIP1 cDNA ORF Clone, Human, C-Myc tag HG11268-CM
RIPK1/RIP1 cDNA ORF Clone, Human, N-Myc tag HG11268-NM
RIPK1/RIP1 qPCR Primer Pairs, Human HP101152
info info
添加购物车成功! 添加购物车失败!