RIPK1/RIP1 cDNA ORF Clone, Human, untagged

Cat: HG11268-M-N

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RIPK1/RIP1 Reagents
CRO Services

All RIPK1/RIP1 Reagents
RIPK1/RIP1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2016 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for three point mutations: 84 T/C, 381 C/T, 910 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human receptor (TNFRSF)-interacting serine-threonine kinase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 2.02kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RIPK1/RIP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RIPK1/RIP1 cDNA ORF Clone, Human, untagged Validated Images
Human RIPK1/RIP1 Gene Plasmid Map 7416
RIPK1/RIP1 cDNA ORF Clone, Human, untagged Alternative Names
RIP cDNA ORF Clone, Human;RIP1 cDNA ORF Clone, Human
RIPK1/RIP1 Background Information
Full Name
receptor (TNFRSF)-interacting serine-threonine kinase 1

RIPK1/RIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RIPK1/RIP1 cDNA ORF Clone in Cloning Vector, Mouse MG51051-G
RIPK1/RIP1 cDNA ORF Clone, Mouse, untagged MG51051-UT
RIPK1/RIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51051-ACGLN
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51051-ACG
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51051-ANG
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51051-ACR
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51051-ANR
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51051-CF
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51051-NF
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-His tag MG51051-CH
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-His tag MG51051-NH
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-HA tag MG51051-CY
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-HA tag MG51051-NY
RIPK1/RIP1 cDNA ORF Clone, Mouse, C-Myc tag MG51051-CM
RIPK1/RIP1 cDNA ORF Clone, Mouse, N-Myc tag MG51051-NM
RIPK1/RIP1 qPCR Primer Pairs, Mouse MP201009

RIPK1/RIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RIPK1/RIP1 cDNA ORF Clone in Cloning Vector, Human HG11268-M
RIPK1/RIP1 cDNA ORF Clone, Human, untagged HG11268-UT
RIPK1/RIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11268-ACGLN
RIPK1/RIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11268-ACG
RIPK1/RIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11268-ANG
RIPK1/RIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11268-ACR
RIPK1/RIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11268-ANR
RIPK1/RIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11268-CF
RIPK1/RIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11268-NF
RIPK1/RIP1 cDNA ORF Clone, Human, C-His tag HG11268-CH
RIPK1/RIP1 cDNA ORF Clone, Human, N-His tag HG11268-NH
RIPK1/RIP1 cDNA ORF Clone, Human, C-HA tag HG11268-CY
RIPK1/RIP1 cDNA ORF Clone, Human, N-HA tag HG11268-NY
RIPK1/RIP1 cDNA ORF Clone, Human, C-Myc tag HG11268-CM
RIPK1/RIP1 cDNA ORF Clone, Human, N-Myc tag HG11268-NM
RIPK1/RIP1 qPCR Primer Pairs, Human HP101152
info info
添加购物车成功! 添加购物车失败!