Text Size:AAA

Human RIPK1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RIPK1cDNA Clone Product Information
Gene_bank_ref_id:NM_003804.3
RefSeq ORF Size:2016bp
cDNA Description:Full length Clone DNA of Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1.
Gene Synonym:RIP, RIP1, FLJ39204, RIPK1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-RIPK1
Restriction Site:KpnI + XhoI (5.5kb + 2.02kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 84 T/C, 381 C/T, 910 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Other RIPK1 Protein Products
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
Catalog:HG11268-M-N
List Price: JPY33230.00  (Save JPY0.00)
Price:JPY33230.00      [How to order]
AvailabilityIn Stock
Images
  • Human RIPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"