Text Size:AAA

Human RIPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RIPK1cDNA Clone Product Information
Gene Bank Ref.ID:NM_003804.3
cDNA Size:2016
cDNA Description:ORF Clone of Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1 DNA.
Gene Synonym:RIP, RIP1, FLJ39204, RIPK1
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 84 T/C, 381 C/T, 910 T/C not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
List Price: $345.00  (Save $0.00)
Price:$345.00      [How to order]
Availability5 business days
  • Human RIPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged