After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human RIPK1/RIP1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human RIPK1 cDNA Clone Product Information
NCBI RefSeq:NM_003804.3
RefSeq ORF Size:2016bp
cDNA Description:Full length Clone DNA of Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1.
Gene Synonym:RIP, RIP1, FLJ39204, RIPK1
Restriction Site:KpnI + XhoI (5.5kb + 2.02kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 84 T/C, 381 C/T, 910 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RIPK1 Gene Plasmid Map
Human RIPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG11268-M-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human RIPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.