_×
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG12054-G-Y
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

RELA cDNA Clone Datasheet

 

RELA cDNA Clone Product Information

Gene Bank Ref.ID:

NM_021975

cDNA Size:

1656

Gene Synonym:

p65

Source: Human

RELA cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) DNA.

Vector:

pCMV/hygro-HA

HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

RELA cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

RELA cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

RELA cDNA Clone Sequence and Quality Control

Sequence:

 
1        ATGGACGAAC TGTTCCCCCT CATCTTCCCG GCAGAGCCAG CCCAGGCCTC TGGCCCCTAT
61       GTGGAGATCA TTGAGCAGCC CAAGCAGCGG GGCATGCGCT TCCGCTACAA GTGCGAGGGG
121      CGCTCCGCGG GCAGCATCCC AGGCGAGAGG AGCACAGATA CCACCAAGAC CCACCCCACC
181      ATCAAGATCA ATGGCTACAC AGGACCAGGG ACAGTGCGCA TCTCCCTGGT CACCAAGGAC
241      CCTCCTCACC GGCCTCACCC CCACGAGCTT GTAGGAAAGG ACTGCCGGGA TGGCTTCTAT
301      GAGGCTGAGC TCTGCCCGGA CCGCTGCATC CACAGTTTCC AGAACCTGGG AATCCAGTGT
361      GTGAAGAAGC GGGACCTGGA GCAGGCTATC AGTCAGCGCA TCCAGACCAA CAACAACCCC
421      TTCCAAGTTC CTATAGAAGA GCAGCGTGGG GACTACGACC TGAATGCTGT GCGGCTCTGC
481      TTCCAGGTGA CAGTGCGGGA CCCATCAGGC AGGCCCCTCC GCCTGCCGCC TGTCCTTTCT
541      CATCCCATCT TTGACAATCG TGCCCCCAAC ACTGCCGAGC TCAAGATCTG CCGAGTGAAC
601      CGAAACTCTG GCAGCTGCCT CGGTGGGGAT GAGATCTTCC TACTGTGTGA CAAGGTGCAG
661      AAAGAGGACA TTGAGGTGTA TTTCACGGGA CCAGGCTGGG AGGCCCGAGG CTCCTTTTCG
721      CAAGCTGATG TGCACCGACA AGTGGCCATT GTGTTCCGGA CCCCTCCCTA CGCAGACCCC
781      AGCCTGCAGG CTCCTGTGCG TGTCTCCATG CAGCTGCGGC GGCCTTCCGA CCGGGAGCTC
841      AGTGAGCCCA TGGAATTCCA GTACCTGCCA GATACAGACG ATCGTCACCG GATTGAGGAG
901      AAACGTAAAA GGACATATGA GACCTTCAAG AGCATCATGA AGAAGAGTCC TTTCAGCGGA
961      CCCACCGACC CCCGGCCTCC ACCTCGACGC ATTGCTGTGC CTTCCCGCAG CTCAGCTTCT
1021     GTCCCCAAGC CAGCACCCCA GCCCTATCCC TTTACGTCAT CCCTGAGCAC CATCAACTAT
1081     GATGAGTTTC CCACCATGGT GTTTCCTTCT GGGCAGATCA GCCAGGCCTC GGCCTTGGCC
1141     CCGGCCCCTC CCCAAGTCCT GCCCCAGGCT CCAGCCCCTG CCCCTGCTCC AGCCATGGTA
1201     TCAGCTCTGG CCCAGGCCCC AGCCCCTGTC CCAGTCCTAG CCCCAGGCCC TCCTCAGGCT
1261     GTGGCCCCAC CTGCCCCCAA GCCCACCCAG GCTGGGGAAG GAACGCTGTC AGAGGCCCTG
1321     CTGCAGCTGC AGTTTGATGA TGAAGACCTG GGGGCCTTGC TTGGCAACAG CACAGACCCA
1381     GCTGTGTTCA CAGACCTGGC ATCCGTCGAC AACTCCGAGT TTCAGCAGCT GCTGAACCAG
1441     GGCATACCTG TGGCCCCCCA CACAACTGAG CCCATGCTGA TGGAGTACCC TGAGGCTATA
1501     ACTCGCCTAG TGACAGGGGC CCAGAGGCCC CCCGACCCAG CTCCTGCTCC ACTGGGGGCC
1561     CCGGGGCTCC CCAATGGCCT CCTTTCAGGA GATGAAGACT TCTCCTCCAT TGCGGACATG
1621     GACTTCTCAG CCCTGCTGAG TCAGATCAGC TCCGCT1TATC CTTACGACGT GCCTGACTAC
1681     GCC2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. HA Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"