Quick Order

Human RB1/OSRC Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human RB1/OSRC cDNA Clone Product Information
NCBI RefSeq:NM_000321.2
RefSeq ORF Size:2787bp
cDNA Description:Full length Clone DNA of Homo sapiens retinoblastoma 1.
Gene Synonym:RB, pRb, OSRC, pp110, p105-Rb
Restriction Site:HindIII + XhoI (5.5kb + 2.79kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RB1/OSRC Gene Plasmid Map
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10137-M-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.